Search Result

Results for "

(R)-3-Hydroxybutanoic acid (sodium)

" in MedChemExpress (MCE) Product Catalog:

By Targets:	Amino Acid Decarboxylase (2) Amino Acid Derivatives (1335) Amino acid Transporter (5) Apical Sodium-Dependent Bile Acid Transporter (4) Fatty Acid Synthase (FASN) (11) Free Fatty Acid Receptor (7) G protein-coupled Bile Acid Receptor 1 (16) Hydroxycarboxylic Acid Receptor (HCAR) (7) Na+/H+ Exchanger (NHE) (1) Na+/K+ ATPase (4) Sodium Channel (2) 11β-HSD (4) 5 alpha Reductase (2) 5-HT Receptor (9) ABA Receptor (1) Acetolactate Synthase (ALS) (1) Acetyl-CoA Carboxylase (6) Acyltransferase (5) ADC Linker (6) ADC Payload (2) Adenosine Receptor (1) Adenylate Cyclase (4) AIM2 (1) Akt (14) Aldehyde Dehydrogenase (ALDH) (1) Aminoacyl-tRNA Synthetase (1) Aminopeptidase (1) AMPK (3) Amyloid-β (5) Androgen Receptor (2) Angiotensin Receptor (1) Angiotensin-converting Enzyme (ACE) (9) Antibiotic (35) Antifolate (13) AP-1 (3) Apelin Receptor (APJ) (1) Apolipoprotein (1) Apoptosis (89) Arginase (1) Aryl Hydrocarbon Receptor (1) ASCT (4) ATF6 (1) Atg8/LC3 (1) Autophagy (30) Bacterial (139) Bcl-2 Family (3) Beta-lactamase (2) Biochemical Assay Reagents (388) Bombesin Receptor (1) Calcium Channel (14) CaMK (3) Cannabinoid Receptor (8) Carbamoyl Phosphate Synthetase (CPS) (1) Carbonic Anhydrase (3) Carboxylesterase (CES) (5) Carboxypeptidase (1) Casein Kinase (4) Caspase (8) Cathepsin (3) CCR (1) CD38 (1) CD73 (1) Ceramidase (4) CGRP Receptor (2) CHIKV (2) Chloride Channel (2) Cholecystokinin Receptor (8) Cholinesterase (ChE) (7) Complement System (3) COMT (3) COX (18) CXCR (2) Cyclic GMP-AMP Synthase (1) Cytochrome P450 (23) DAGL (1) Dihydroorotate Dehydrogenase (2) Dipeptidyl Peptidase (1) DNA Stain (9) DNA-PK (4) DNA/RNA Synthesis (59) Dopamine Receptor (3) Dopamine Transporter (4) Dopamine β-hydroxylase (1) Drug Derivative (55) Drug Intermediate (37) Drug Isomer (12) Drug Metabolite (43) EAAT (5) EBV (1) EGFR (1) Elastase (1) ELOVL (1) Endogenous Metabolite (390) Endothelin Receptor (4) Enterovirus (1) Epigenetic Reader Domain (3) Epoxide Hydrolase (5) ERK (6) Estrogen Receptor/ERR (4) FAAH (10) FABP (2) Factor Xa (1) FATP (1) Ferroportin (1) Ferroptosis (7) FGFR (3) FLAP (1) Fluorescent Dye (91) Folate Receptor (FR) (1) Fungal (28) FXR (16) G-quadruplex (1) GABA Receptor (29) Gap Junction Protein (1) GCGR (17) GHSR (1) GLP Receptor (16) GLUT (2) Glutathione Peroxidase (1) Glutathione Reductase (GR) (1) Glutathione S-transferase (1) Glycosidase (8) GnRH Receptor (1) GPR84 (2) Guanylate Cyclase (3) HBV (1) HCV (3) HDAC (8) Herbicide (7) HIF/HIF Prolyl-Hydroxylase (3) Histamine Receptor (18) Histone Acetyltransferase (1) Histone Demethylase (5) Histone Methyltransferase (2) HIV (15) HMG-CoA Reductase (HMGCR) (1) HPPD (1) HPV (1) HSP (3) HSV (3) iGluR (15) Influenza Virus (8) Insulin Receptor (4) Integrin (5) Interleukin Related (16) Isocitrate Dehydrogenase (IDH) (2) Isotope-Labeled Compounds (39) JNK (2) Keap1-Nrf2 (8) Lactate Dehydrogenase (1) LDLR (2) Leukotriene Receptor (2) Ligands for E3 Ligase (1) Ligands for Target Protein for PROTAC (1) Lipase (5) Liposome (26) Lipoxygenase (9) LPL Receptor (6) LXR (2) mAChR (5) MAGL (3) MARCKS (2) MCHR1 (GPR24) (1) MDM-2/p53 (2) Melanocortin Receptor (3) mGluR (3) MicroRNA (1) Microtubule/Tubulin (2) Mitochondrial Metabolism (13) Mitophagy (2) MMP (6) Molecular Glues (1) Monoamine Oxidase (6) Monocarboxylate Transporter (1) mTOR (9) Na+/HCO3- Cotransporter (1) nAChR (3) Natriuretic Peptide Receptor (NPR) (1) Necroptosis (4) Neurokinin Receptor (4) Neurotensin Receptor (2) NF-κB (12) NKCC (1) NO Synthase (10) NOD-like Receptor (NLR) (2) Nuclear Hormone Receptor 4A/NR4A (2) Nucleoside Antimetabolite/Analog (20) OAT (4) Opioid Receptor (1) Orexin Receptor (OX Receptor) (2) Orphan GPCR (1) Orthopoxvirus (3) Oxidative Phosphorylation (2) Oxytocin Receptor (1) P-glycoprotein (2) P2Y Receptor (3) p38 MAPK (6) p62 (2) p97 (1) PAI-1 (1) Parasite (25) PARP (1) PD-1/PD-L1 (2) PDHK (2) PDI (1) PDK-1 (1) Peptide-Drug Conjugates (PDCs) (1) PGC-1α (1) Phosphatase (11) Phosphodiesterase (PDE) (9) Phospholipase (13) Photosystem II (1) Phytohormone (5) PI3K (10) PKA (7) PKC (15) PKG (1) Platelet-activating Factor Receptor (PAFR) (2) Potassium Channel (14) PPAR (17) Pregnane X Receptor (PXR) (1) Prostaglandin Receptor (14) Protease Activated Receptor (PAR) (3) Proteasome (5) Protein Arginine Deiminase (1) Proton Pump (27) PSMA (1) Pyroptosis (2) Pyruvate Carboxylase (PC) (2) Pyruvate Kinase (2) Radionuclide-Drug Conjugates (RDCs) (1) Raf (1) RAR/RXR (11) Ras (1) Reactive Oxygen Species (ROS) (27) Reference Standards (197) Reverse Transcriptase (1) RIP kinase (1) ROCK (7) ROR (5) ROS Kinase (3) RSV (1) RXFP Receptor (1) SARS-CoV (6) Scavenger Receptor Class B type I (SR-BI） (2) Secretin Receptor (2) Ser/Thr Protease (4) Sialyltransferase (1) Sirtuin (1) Small Interfering RNA (siRNA) (4) Somatostatin Receptor (3) Src (1) STAT (6) Stearoyl-CoA Desaturase (SCD) (6) Steroid Sulfatase (1) Succinate Dehydrogenase (1) Survivin (1) Taste Receptor (4) Tau Protein (4) Telomerase (1) TET Protein (1) TGF-beta/Smad (3) Thrombin (1) Thyroid Hormone Receptor (1) TMV (2) TNF Receptor (9) Toll-like Receptor (TLR) (1) TOPK (4) Topoisomerase (2) Transmembrane Glycoprotein (2) Transthyretin (TTR) (2) TRP Channel (10) TrxR (1) Tryptophan Hydroxylase (1) Tyrosinase (5) Tyrosine Hydroxylase (1) URAT1 (9) Urea Transporter (1) Vasopressin Receptor (5) VD/VDR (1) VEGFR (2) Virus Protease (1) Wnt (2) Xanthine Oxidase (7) α-synuclein (4) β-catenin (2) β-glucuronidase (2) γ-Glutamyl Transferase (GGT) (1)
By Research Areas:	Cancer (350) Cardiovascular Disease (122) Endocrinology (58) Infection (214) Inflammation/Immunology (291) Metabolic Disease (484) Neurological Disease (227)
Click Chemistry:	Labeling and Fluorescence Imaging (5) Azide (39) Alkynes (41)
Oligonucleotides:	Guanosine (1) Nucleotide Analogs (9) Phospholipids (6) siRNA drugs (4) Antisense Oligonucleotides (4) Guanine (1) siRNAs (4) Pegylated Lipids (4) Nucleoside Analogs (4) Disintegrants (1) Cationic Lipids (8) Cytosine (1) Polymers (1) Adenosine (1) Thickeners (1) Nucleoside Phosphoramidites (3) Suspending Agents (1) Solubilizing Agents (1) Freeze-drying Protective Agents (1) Cytidine (1) Cholesterol (2) Cytidine Nucleotide (2) Aptamers (2) Uridine (1) Emulsifiers (1) Uracil (1) Sweetening Agents (1)

3366

Inhibitors & Agonists

Fluorescent Dye

301

Biochemical Assay Reagents

1654

Peptides

518

Natural
Products

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Targets Recommended: Sodium Phosphate Cotransporter Sodium Channel Apical Sodium-Dependent Bile Acid Transporter Na+/H+ Exchanger (NHE) SGLT Na+/K+ ATPase Amino acid Transporter Amino Acid Derivatives Amino Acid Decarboxylase Hydroxycarboxylic Acid Receptor (HCAR) Amino Acid Oxidase Free Fatty Acid Receptor Fatty Acid Synthase (FASN) G protein-coupled Bile Acid Receptor 1

Cat. No.	Product Name	Target	Research Areas	Chemical Structure

HY-W015851

*(R)-3-Hydroxybutanoic* acid sodium** 5 Publications Verification (R)-(-)-3-Hydroxybutanoic acid sodium; (R)-3-Hydroxybutyric acid sodium	Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .

HY-W051723

*(R)-3-Hydroxybutanoic* acid** 5 Publications Verification (R)-(-)-3-Hydroxybutanoic acid; (R)-3-Hydroxybutyric acid	Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones .

HY-W015851S2

*(R)-3-Hydroxybutanoic* acid-13C4 sodium** (R)-(-)-3-Hydroxybutanoic acid-¹³C₄ sodium; (R)-3-Hydroxybutyric acid-¹³C₄ sodium	Isotope-Labeled Compounds Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid- ¹³C₄ sodium is a ¹³C labeled (R)-3-Hydroxybutanoic acid (HY-W051723). (R)-3-Hydroxybutanoic acid is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .

HY-B0228S10

*(R)-3-Hydroxybutanoic* acid-13C2 sodium** (R)-(-)-3-Hydroxybutanoic acid-¹³C₂ sodium; (R)-3-Hydroxybutyric acid-¹³C₂ sodium	Isotope-Labeled Compounds Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid- ¹³C₂ sodium is the ¹³C labeled (R)-3-Hydroxybutanoic acid sodium (HY-W015851). (R)-3-Hydroxybutanoic acid sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones ^[3].

HY-W654002

(3R)-3-Hydroxybutyric acid-1-13C	Isotope-Labeled Compounds Endogenous Metabolite	Others
(3R)-3-Hydroxybutyric acid-1- ¹³C is ¹³C labeled (R)-3-Hydroxybutanoic acid. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones ^[3].

HY-P0041A

F992 TFA	Vasopressin Receptor	Neurological Disease
F992 TFA is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .

HY-W015851R

*(R)-3-Hydroxybutanoic* acid sodium (Standard)** (R)-(-)-3-Hydroxybutanoic acid sodium (Standard); (R)-3-Hydroxybutyric acid sodium (Standard)	Reference Standards Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid (sodium) (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid (sodium). This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones[1][2].

HY-W051723R

*(R)-3-Hydroxybutanoic* acid (Standard)** (R)-(-)-3-Hydroxybutanoic acid (Standard); (R)-3-Hydroxybutyric acid (Standard)	Reference Standards Endogenous Metabolite	Metabolic Disease
(R)-3-Hydroxybutanoic acid (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid. This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones[1][2].

HY-P0041

F992	Vasopressin Receptor	Neurological Disease
F992 is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .

HY-P10876

mcK6A1	Amyloid-β	Neurological Disease
mcK6A1 is an inhibitor for the aggregation of amyloid-β (Aβ), that selectively binds to the 16KLVFFA21 segment of Aβ42, forms an extended β-folded structure, and inhibits the formation of Aβ42 oligomers. mcK6A1 can be used in research of Alzheimer's disease and other amyloid-related diseases .

HY-P10218A

MANS peptide TFA	MARCKS PKC	Inflammation/Immunology Cancer
MANS peptide TFA is the TFA salt form of MANS peptide (HY-P10218). MANS peptide TFA is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .

HY-P10218

MANS peptide	MARCKS PKC	Inflammation/Immunology Cancer
MANS peptide is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .

HY-169089A

RP-182-PEG3-K(palmitic acid) TFA	Drug Derivative	Cancer
RP-182-PEG3-K(palmitic acid) (Compound 1a) TFA is a fatty acid derivative of the immunomodulatory peptide RP-182. RP-182-PEG3-K(palmitic acid) TFA inhibits CD206 ^high M2-like macrophage (IC₅₀ of 3.2 μM) and induces phagocytosis. RP-182-PEG3-K(palmitic acid) TFA exhibits antitumor efficacy in mouse B16 melanoma allografts .

HY-169089

RP-182-PEG3-K(palmitic acid)	Drug Derivative	Cancer
RP-182-PEG3-K palmitic acid (Compound 1a) is a fatty acid derivative of the immunomodulatory peptide RP-182. RP-182-PEG3-K palmitic acid inhibits CD206 ^high M2-like macrophage (IC₅₀ of 3.2 μM) and induces phagocytosis. RP-182-PEG3-K palmitic acid exhibits antitumor efficacy in mouse B16 melanoma allografts .

HY-P2231

Cotadutide 1 Publications Verification MEDI0382	GCGR	Metabolic Disease
Cotadutide (MEDI0382) is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC₅₀ values of 6.9 pM and 10.2 pM, respectively. Cotadutide exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide can be used in the research of obesity and type 2 diabetes (T2D) ^[3].

HY-P2231A

Cotadutide acetate 1 Publications Verification MEDI0382 acetate	GCGR	Metabolic Disease
Cotadutide (MEDI0382) acetate is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC₅₀ values of 6.9 pM and 10.2 pM, respectively. Cotadutide acetate exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide acetate can be used in the research of obesity and type 2 diabetes (T2D) ^[3].

HY-P0014A

Liraglutide acetate	GLP Receptor	Metabolic Disease
Liraglutide acetate is the acetate form of Liraglutide (HY-P0014), a glucagon-like peptide-1 (GLP-1) receptor agonist studied in type 2 diabetes .

HY-P0014

Liraglutide 25+ Cited Publications	GCGR GLP Receptor	Metabolic Disease Cancer
Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus.

HY-P10869

dCNP 1 Publications Verification	Natriuretic Peptide Receptor (NPR)	Inflammation/Immunology Cancer
dCNP binds to NPR-B/C receptor, activates cGMP signaling pathway, and regulates vascular function. dCNP exhibits anti-hypoxia property through downregulation of hypoxia-related genes expressions like HIF1α and HIF2α. dCNP inhibits the induction of tumor stroma and exhibits anti-fibrosis activity. dCNP upregulates CTLs, NK cells, and conventional type 1 dendritic cells in tumors, and activates immune responses .

HY-P0014B

Liraglutide TFA 25+ Cited Publications	GLP Receptor	Metabolic Disease
Liraglutide (TFA) is an agonist of glucagon-like peptide 1 receptor (GLP-1). Liraglutide (TFA) can activate GLP-1, leading to the release of insulin in the presence of increased glucose concentration. Liraglutide (TFA) also reduces glucagon secretion in a glucose-dependent manner. Liraglutide (TFA) can be studied in research on type 2 diabetes .

HY-P10318

SHR-2042	GLP Receptor	Endocrinology
SHR-2042 is a selective agonist of the GLP-1 receptor.SHR-2042 improves glycemic control by activating the GLP-1 receptor, enhancing insulin secretion and inhibiting glucagon secretion. SHR-2042 combined with sodium N-(8-[2-hydroxybenzoyl] amino) caprylate (SNAC) promotes monomerization through the formation of micelles and improves oral absorption efficiency .

HY-P10200

CP7-FP13-2	Bacterial	Infection
CP7-FP13-2 is a peptide with antivirulence factor and antibacterial activity. CP7-FP13-2 inhibits the formation of Staphylococcus aureus biofilm and has good antibacterial efficacy in mice .

HY-P3291

Dapiglutide 1 Publications Verification ZP7570	GCGR	Metabolic Disease
Dapiglutide (ZP7570) is a long-acting glucagon-like peptide-1 receptor 1R (GLP-1R)/Glucagon-like peptide-2 receptor (GLP-2R) dual agonist. Dapiglutide alleviates intestinal dysfunction in a mouse short bowel model and has anti-obesity effects ^[3].

HY-P11233

Acmopatide	GLP Receptor	Metabolic Disease
Acmopatide (Compound E-153) is a dual-acting GIP/GLP-1 receptor agonist. Acmopatide is used in anti-diabetic research .

HY-P5161

FC382K10W15	GLP Receptor GCGR	Metabolic Disease
FC382K10W15 is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 can be used in type 2 diabetes research .

HY-P5161A

FC382K10W15 TFA	GLP Receptor GCGR	Metabolic Disease
FC382K10W15 TFA is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 TFA can be used in type 2 diabetes research .

HY-P3462

Cagrilintide 3 Publications Verification	CGRP Receptor	Metabolic Disease
Cagrilintide is an investigational novel long-acting acylated amylin analogue, acts as nonselective amylin receptors (AMYR) and calcitonin G protein-coupled receptor (CTR) agonist. Cagrilintide induces significant weight loss and reduces food intake. Cagrilintide has the potential for the research of obesity ^[3].

HY-P3462A

Cagrilintide acetate 3 Publications Verification	CGRP Receptor	Metabolic Disease
Cagrilintide acetate is a non-selective AMYR/CTR agonist and long-acting acylated amylase analogue. Cagrilintide acetate causes a reduction in food intake and significant weight loss in a dose-dependent manner. Cagrilintide acetate can be used in obesity studies ^[3].

HY-P3143

BMSpep-57	PD-1/PD-L1	Cancer
BMSpep-57 is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC₅₀ of 7.68 nM. BMSpep-57 binds to PD-L1 with K_ds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 facilitates T cell function by in creasing IL-2 production in PBMCs .

HY-P3143A

BMSpep-57 hydrochloride	PD-1/PD-L1	Cancer
BMSpep-57 hydrochloride is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC₅₀ of 7.68 nM. BMSpep-57 hydrochloride binds to PD-L1 with K_ds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 hydrochloride facilitates T cell function by in creasing IL-2 production in PBMCs .

HY-P0014AS

Liraglutide-d8 tetraTFA	Isotope-Labeled Compounds GLP Receptor	Metabolic Disease
Liraglutide-d₈ tetraTFA is deuterium labeled Liraglutide (HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used for the study of type 2 diabetes mellitus .

HY-P0014S2

Liraglutide-13C6,15N TFA	Isotope-Labeled Compounds	Others
Liraglutide- ¹³C₆, ¹⁵N (TFA)is the ¹³C and ¹⁵N labeledLiraglutide(HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .

HY-P0014S1

Liraglutide-13C5,15N TFA	Isotope-Labeled Compounds GLP Receptor GCGR	Others
Liraglutide- ¹³C₅, ¹⁵N (tetraTFA) is the ¹³C and ¹⁵N labeled Liraglutide (HY-P0014) . Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .

HY-P10271

RG7697 NNC0090-2746; MAR709; RO6811135	GLP Receptor	Metabolic Disease
RG7697 is a dual agonist for glucagon-like peptide receptor (GLP Receptor) and glucosedependent insulinotropic polypeptide receptor (GIPR), with EC₅₀ of 5 and 3 pM, respectively. RG7697 exhibits antihyperglycemic property .

HY-P10341

ZP3022	GCGR	Metabolic Disease
ZP3022 is a dual agonist of glucagon-like peptide-1 (GLP-1) and gastrin that has the ability to sustainably improve glycemic control. Additionally, ZP3022 can effectively increase β-cell mass, promote β-cell proliferation, and enhance the function of pancreatic islets. ZP3022 can be used in anti-diabetic research .

HY-W040233B

*L-Lactic acid (sodium) (purity≥90%)* 10+ Cited Publications (S)-2-Hydroxypropanoic acid (sodium) (purity≥90%)	Drug Intermediate	Others
Sodium (S)-2-hydroxypropanoate (Sodium L-lactate) (purity≥90%) is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid .

HY-113560

Plipastatin B1	Antibiotic Fungal Phospholipase	Infection
Plipastatin B1 is a lipopeptide antibiotic, an inhibitor of phospholipase A₂ (PLA2), which has antifungal activity .

HY-P11273

Urcosimod OK 101	Biochemical Assay Reagents	Inflammation/Immunology
Urcosimod (OK 101) is an immunomodulator and anti-inflammatory agent .

HY-P11290

MC4-NN2-0453	Melanocortin Receptor	Metabolic Disease
MC4-NN2-0453, a α-MSH analog, is a selective MC4R agonist. MC4-NN2-0453 can be used for obesity research .

HY-P1162

(d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin SKF 100273	Vasopressin Receptor	Metabolic Disease
(d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin (SKF 100273) is a vasopressin V1 receptor selective antagonist .

HY-P2595

SKF 103784	Endogenous Metabolite	Cardiovascular Disease
SKF 103784 is an vasopressin antagonist with activity against vasopressin. SKF 103784 inhibits the physiological response caused by antidiuretic and is therefore used to study biological processes related to water and salt balance. SKF 103784 can also be used to explore pathological mechanisms related to cardiovascular diseases and endocrine dysfunction .

HY-153476

GIP/GLP-1 dual receptor agonist-1	GCGR	Metabolic Disease
GIP/GLP-1 dual receptor agonist-1 (compound 4) is a GIP/GLP-1 receptor agonist. GIP/GLP-1 dual receptor agonist-1 can be used in the research of metabolic disorders and fatty liver diseases, including nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD) .

HY-153476A

GIP/GLP-1 dual receptor agonist-1 sodium	Insulin Receptor GLP Receptor	Metabolic Disease
GIP/GLP-1 dual receptor agonist-1 (Compound 4) (sodium) is a GIP/GLP-1 receptor agonist. GIP/GLP-1 dual receptor agonist-1 (sodium) can be used in the research of metabolic disorders and fatty liver diseases, including nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD).

HY-P4895

(d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin	Oxytocin Receptor	Neurological Disease
(d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin (OVT) is an oxytocin receptor antagonist. (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin can be used for the research of neurological disease .

HY-132582A

*Tau ASO-12 (murine) (sodium)*	Tau Protein	Cancer
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-W718145

*D-Mannose,6-dihydrogen phosphate (sodium)*	Biochemical Assay Reagents	Others
D-Mannose,6-(dihydrogen phosphate) (sodium) is a class of biochemical reagents used in glycobiology research. Glycobiology studies the structure, synthesis, biology, and evolution of sugars. It involves carbohydrate chemistry, enzymology of glycan formation and degradation, protein-glycan recognition, and the role of glycans in biological systems. This field is closely related to basic research, biomedicine, and biotechnology .

HY-P10272

Rusfertide PTG-300	Ferroportin	Others
Rusfertide is a peptide mimetic of natural hepcidin, which targets and degrades ferroportin, reduces serum iron and transferrin-saturation, and thus regulates the production of red blood cells. Rusfertide ameliorates the polycythemia vera, β-thalassemia and hereditary hemochromatosis .

HY-134442

*L-α-Phosphatidylinositol (liver, bovine) (sodium)*	Biochemical Assay Reagents	Others
L-α-Phosphatidylinositol (liver, bovine) (sodium) is a biochemical reagent.

HY-A0203A

*Pentosan Polysulfate (Sodium) (W/W 43%)* 1 Publications Verification	HIV	Infection Inflammation/Immunology Cancer
Pentosan Polysulfate Sodium is an orally bioavailable, semi-synthetic medication with anti-inflammatory and pro-chondrogenic properties. Pentosan Polysulfate Sodium also is a potent and selective anti-HIV agent. Pentosan Polysulfate Sodium is used for the treatment of interstitial cystitis ^[3].

HY-N7755

*Estradiol 3-(β-D-Glucuronide) (sodium)*	Estrogen Receptor/ERR	Cancer
Estradiol 3-(β-D-Glucuronide) sodium is the glucuronic acid derivative of estradiol (HY-B0141). Estradiol 3-(β-D-Glucuronide) sodium is radiolabeled for use in tumor imaging and biodistribution studies .

Cat. No.	Product Name	Type

HY-126172

9-Anthryldiazomethane	Fluorescent Dyes/Probes
9-Anthryldiazomethane is a fluorescent labeling reagent, which can be used for detecting fatty acids and derivatives .

HY-D1319A

Cyanine5 carboxylic acid bromide Cy5 acid bromide	Fluorescent Dyes/Probes
Cyanine5 carboxylic acid (bromide) is a fluorescent dye containing a non-activated carboxylic acid (Ex=646 nm, Em=662 nm). Cyanine5 carboxylic acid chloride is an non-reactive dye that can be used in control samples .

HY-D1457

DND-189	Fluorescent Dyes/Probes
DND-189, a low-pH fluorescent probe, is sensitive to neutral and low pH range. DND-189 can be used to measure the pH of acidic organelles .

HY-D0115

7-Hydroxycoumarin-3-carboxylic acid N-succinimidyl ester	Fluorescent Dyes/Probes
7-Hydroxycoumarin-3-carboxylic acid N-succinimidyl ester is the amine-reactive succinimidyl ester of 7-Hydroxycoumarin-3-carboxylic acid. 7-Hydroxycoumarin-3-carboxylic acid N-succinimidyl ester is a blue fluorescent dye for labeling proteins and nucleic acids .

HY-D1683A

NBD-X PE	Fluorescent Dyes/Probes
NBD-X PE is a derivative of NBD-PE, where the NBD part is replaced by NBD-X acid.

HY-D2857

NBD-Stearic acid	Fluorescent Dyes/Probes
NBD-Stearic acid is a stearic acid labeled with a nitrobenzoxadiazole (NBD) fluorophore. NBD-Stearic acid can be used as a probe for fatty acid uptake or the the ligand binding sites of fatty acid and sterol carrier proteins (FABP)

HY-W297715

7-Acetoxy-4-bromomethylcoumarin	Fluorescent Dyes/Probes
7-Acetoxy-4-bromomethylcoumarin acts as a fluorescence label for fatty acids.

HY-131461

6-TET Dipivaloate	Fluorescent Dyes/Probes
6-TET Dipivaloate is a nucleic acid sequencing probe.

HY-D2283

Photo-DL-lysine	Dyes
Photo-DL-lysine is a DL-lysine-based photo-reactive amino acid, captures proteins that bind lysine post-translational modifications .

HY-W479534

Decanoyl m-Nitroaniline DemNA	Dyes
Decanoyl m-Nitroaniline (DemNA) is a nitroaniline fatty acid amides which can be used to measure fatty acid amide hydrolase (FAAH) activity (Ab = 410 nm).

HY-D1830

Vari Fluor 680 Carboxylic acid（free acid） VF 680 Carboxylic acid（free acid）	Dyes
Vari Fluor 680 Carboxylic acid (VF 680 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-141576

C6-NBD Sphinganine	Fluorescent Dyes/Probes
C6-NBD Sphinganine is a sphinganine analog and can be used as fluorescent dye for labeling fatty acid .

HY-15939

6-FAM SE	Oligonucleotide Labeling
6-FAM SE (6-carboxyfluorescein succinimidyl ester) is a fluorescent labeling reagent. 6-FAM SE is used for oligonucleotide labeling and DNA sequencing .

HY-D0996

LDS-751

DNA Stain

Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 is a nucleic acid stain that mainly detects DNA. Lds-751 has a high affinity for DNA and fluorescence is enhanced after binding, but the maximum emission wavelength is 670nm. Lds-751 and Thiazole orange can be used for the differentiation of red blood cells, platelets, reticulocytes, and nucleated cells and can be stimulated at 488nm. Studies have shown that LDS-751 binds almost exclusively to mitochondria when incubated with nucleated living cells. After nucleated Acridine Orange (HY-101879) staining and LDS-751 treatment of cells, confocal microscopy revealed almost no co-location of the cells. Staining with Rhodamine 123 (HY-D0816), a dye known to bind polarized mitochondria, was almost identical to the pattern observed with LDS-751 ^[3].

HY-D1825

Vari Fluor 532 Carboxylic acid（free acid） VF 532 Carboxylic acid（free acid）	Dyes
Vari Fluor 532 Carboxylic acid (VF 532 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D0942

Acridine Orange zinc chloride salt 25+ Cited Publications Euchrysine 3RX	DNA Stain
Acridine Orange (Euchrysine 3RX) zinc chloride salt is a cell-penetrable nucleic acid-selective fluorescent dye. Acridine Orange zinc chloride salt produces orange fluorescence when it binds to ssDNA or RNA, and green fluorescence when it binds to dsDNA (Ex: 488 nM; Em: green fluorescence at 530 nm, orange fluorescence at 640 nm) ^[3].

HY-D0941

5-Carboxytetramethylrhodamine	Fluorescent Dyes/Probes
5-Carboxytetramethylrhodamine can be used as a fluorescent probe of nucleic acids and proteins. 5-Carboxytetramethylrhodamine displays excitation maxima of 558 nm and an emission maximum of 586 nm ^[3].

HY-D0430

Acid Red 249 Tracid Brilliant Red B	Dyes
Acid Red 249 (Tracid Brilliant Red B) is a kind of weak acid dye containing sulfate ion .

HY-D1821

Vari Fluor 750 Carboxylic acid（free acid） VF 750 Carboxylic acid（free acid）	Dyes
Vari Fluor 750 Carboxylic acid (VF 750 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D1828

Vari Fluor 640 Carboxylic acid（free acid） VF 640 Carboxylic acid（free acid）	Dyes
Vari Fluor 640 Carboxylic acid (VF 640 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D1829

Vari Fluor 568 Carboxylic acid（free acid） VF 568 Carboxylic acid（free acid）	Dyes
Vari Fluor 568 Carboxylic acid (VF 568 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-101879

Acridine Orange hydrochloride 25+ Cited Publications	Fluorescent Dyes/Probes
Acridine Orange hydrochloride is a cell-penetrable nucleic acid-selective fluorescent dye. Acridine Orange hydrochloride produces orange fluorescence when it binds to ssDNA or RNA, and green fluorescence when it binds to dsDNA (Ex: 488 nM; Em: green fluorescence at 530 nm, orange fluorescence at 640 nm) ^[3].

HY-D1826

Vari Fluor 594 Carboxylic acid（free acid） VF 594 Carboxylic acid（free acid）	Dyes
Vari Fluor 594 Carboxylic acid (VF 594 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-W010947

4-Methylumbelliferyl palmitate

Fluorescent Dyes/Probes

4-Methylumbelliferyl palmitate is an excellent fluorophore for measuring acid lipase in human leukocytes. Acidity and solvent have important influence on its fluorescence. 4-Methylumbelliferyl palmitate exists mainly as neutral molecular form which can be produced strong fluorescence at 445 nm in near neutral aqueous solutions, and exist mainly as anion form which can be produced stronger fluorescence at 445 nm in weak alkaline solutions .

HY-D1827

Vari Fluor 660 Carboxylic acid（free acid） VF 660 Carboxylic acid（free acid）	Dyes
Vari Fluor 660 Carboxylic acid (VF 660 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D1578

C12FDGlcU	Fluorescent Dyes/Probes
C12FDGlcU is a lipophilic analog of fluorescein di-β-D-glucuronic acid. C12FDGlcU can be useful for the detection of β-glucuronidase (GUS) gene expression. C12FDGlcU can enter the cells and then be cleaved by β-glucuronidase, generating the yellow-colored, green-fluorescent fluorescein (Abs/Em of the reaction product: 495/518 nm) .

HY-D1823

Vari Fluor 647A Carboxylic acid（free acid） VF 647A Carboxylic acid（free acid）	Dyes
Vari Fluor 647A Carboxylic acid (VF 647A Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D1824

Vari Fluor 488 Carboxylic acid（free acid） VF 488 Carboxylic acid（free acid）	Dyes
Vari Fluor 488 Carboxylic acid (VF 488 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D1822

Vari Fluor 555 Carboxylic acid（free acid） VF 555 Carboxylic acid（free acid）	Dyes
Vari Fluor 555 Carboxylic acid (VF 555 Carboxylic acid) free acid is a carboxylic acid derivative of Vari Fluor. Vari Fluor carboxylic acid derivatives are unactivated labeled fluorescent dyes for protein, antibody, and polysaccharide labeling that require carboxylic acid activation for use .

HY-D2186

BTD probe-1	Fluorescent Dyes/Probes
BTD probe-1 is a benzothiazine-based chemoselective probe for selective labeling of protein S-sulfenic acids in vitro. BTD probe-1 selectively modify sulfenic acid residues in proteins .

HY-W269179

4-Bromomethyl-6,7-dimethoxycoumarin	Fluorescent Dyes/Probes
4-Bromomethyl-6,7-dimethoxycoumarin is a fluorescent label for carboxylic acids in chromatographic detection .

HY-D2176

AF 555 carboxylic acid	Fluorescent Dyes/Probes
AF 555 carboxylic acid is a derivative of the orange fluorescent dye AF 555. AF 555 carboxylic acid is widely used in cell dyes, biological dyes, biomolecules and particle fluorescent labeling. AF 555 exhibits average excitation wavelengths under green laser and red laser of 510 nm and 610 nm, respectively .

HY-D1158

HKOCl-4m	Fluorescent Dyes/Probes
HKOCl-4m is a selective and mitochondria-targeting rhodol-based fluorescent probe for monitoring mitochondrial hypochlorous acid (HOCl) .

HY-115402

DAz-1	Dyes
DAz-1 is a sulfonic acid probe for living cells, which can directly detect sulfonic acid-modified proteins in living cells and is cell-permeable .

HY-D2283S

Photo-DL-lysine-d2	Dyes
Photo-DL-lysine-d₂ is the deuterium labeled Photo-DL-lysine (HY-D2283). Photo-DL-lysine is a DL-lysine-based photo-reactive amino acid, captures proteins that bind lysine post-translational modifications .

HY-130025

HKOCl-3 2 Publications Verification	Fluorescent Dyes/Probes
HKOCl-3 is a highly sensitive and selective fluorescent probe for detecting hypochlorous acid.E_x: 490 nm; E_m 527 nm .

HY-D0150

Thiazole Orange

1 Publications Verification

Fluorescent Dyes/Probes

Thiazole Orange is an asymmetric anthocyanin dye that can be coupled with oligonucleotides (ONs) to prepare fluorescent hybridization probes. Thiazole Orange has been widely used in biomolecular detection and staining of DNA/ RNA in gels and can be used for reticulocyte analysis. Thiazole orange generates a significant fluorescence enhancement and high quantum yield when it binds with nucleic acids, especially RNA. Thiazole orange can permeate living cell membranes. Thiazole orange can use UV light for detection, but can also be detected with blue light. The excitation and emission of Thiazole orange are λ_ex = 510 nm (488 nm and 470 nm also show strong excitation) and λ_em = 527 nm, respectively ^[3] .

HY-D2575

WYneN	Fluorescent Dyes/Probes
WYneN (compound 10) is a functionalized Wittig-alkyne probe. WYneN exhibits strong reactivity with sulfinic acid dipeptide models, similar to the parent Wittig reagent. WYneN can be used to reveal the function of oxidative modifications on a proteome-wide scale .

HY-151751

BDP TMR alkyne	Fluorescent Dyes/Probes
BDP TMR alkyne is an alkyne-containing click chemistry reagent that can click chemistry with azides. BDP TMR alkyne has the fluorophore BDP and can be used for oligonucleotide labeling and amino acid sequencing .

HY-D1617

BODIPY 500/510 C1, C12

1 Publications Verification

Fluorescent Dyes/Probes

BODIPY 500/510 C1, C12 is a BODIPY dye. BODIPY dye is a small molecule dye with strong ultraviolet absorption ability, its fluorescence peak is relatively sharp, and the quantum yield is high. They are relatively insensitive to the polarity and pH of the environment and are relatively stable under different physiological conditions. Due to its structural asymmetry, BODIPY derives a variety of structural products. BODIPY lipid droplet dyes can well pass through the cell membrane into the cell, and localize the neutral lipids in the cell to specifically stain the lipid droplets, which can be used for labeling of live cells and fixed cells . Maximum excitation/emission wavelength: 500/510 nm . Protect from light, stored at -20℃.

HY-D1124

Mordant brown 1	Dyes
Mordant brown 1, a naphthalenesulphonic acid derivative, is an azo dye. Mordant brown 1 is also an effective and specific inhibitor of CD40-CD154 costimulatory protein-protein interaction .

HY-D0785

NBD-F 4-Fluoro-7-nitrobenzofurazan	Fluorescent Dyes/Probes
NBD-F (4-Fluoro-7-nitrobenzofurazan) is a pro-fluorescent reagent which is developed for amino acid analysis. NBD-F reacts with primary or secondary amines to produce a fluorescent product and used for analysis of amino acids and low molecular weight amines .

HY-134564

Fluorescein octadecyl ester	Dyes
Fluorescein octadecyl ester is a lipophilic fluorescent reagent is immobilized in a plasticized PVC membrane. Fluorescein octadecyl ester can reversibly recognize alcohol molecules and can be used to determine the concentration of ethanol in alcoholic drinks. Fluorescein octadecyl ester can be used as acceptor to make optrode membrane for the determination of picric acid .

HY-Y0695

Amido Black 10B Naphthol Blue Black	Protein Labeling
Amido Black 10B (Naphthol Blue Black) is a highly toxic azo dye. Amido Black 10B is genotoxic and mutagenic. Amido Black 10B can cause respiratory problems. Amido Black 10B is used for amino acid dyeing ^[3] .

HY-D1296

Green DND-26 1 Publications Verification	Fluorescent Dyes/Probes
Green DND-26 is a green fluorescently labeled lysosomal probe with a maximum excitation/emission wavelength of 504/511 nm. The structure is composed of a fluorescein group and linked weak bases, which can freely cross the cell membrane and generally gather on spherical organelles. Green DND-26 is suitable for observing the internal biosynthesis and related pathogenesis of lysosomes .

HY-12489

Ponceau S acid Red 112	Dyes
Ponceau S (Acid Red 112) is a non-specific protein dye commonly used as a stain for Western blot. Ponceau S is used in an acidic aqueous solution that is compatible with antibody-antigen binding and dyes the proteins on the membrane red ^[3].

HY-15682G

TTNPB (GMP) Ro 13-7410 (GMP); Arotinoid acid (GMP); AGN191183 (GMP)	Fluorescent Dye
TTNPB (Ro 13-7410) (GMP) is TTNPB (HY-15682) produced by using GMP guidelines. GMP small molecules work appropriately as an auxiliary reagent for cell therapy manufacture. TTNPB is a highly potent retinoic acid receptor (RAR) agonist .

HY-W127715

Lucifer Yellow CH dipotassium salt

3 Publications Verification

Fluorescent Dyes/Probes

Lucifer Yellow CH dipotassium is a high-intensity fluorescent probe containing free hydrazyl groups. Lucifer Yellow CH can react with fatty aldehydes at room temperature. Lucifer Yellow CH serves as a biological tracer to monitor neuronal branching, regeneration, gap junction detection and characterization, and selective ablation of cells after aldehyde fixation. Lucifer yellow CH displays the maximum excitation/emission of 430 nm/540 nm, respectively .

HY-D1738

DAPI dilactate Maximum Cited Publications 93 Publications Verification 4',6-Diamidino-2-phenylindole dilactate	Fluorescent Dyes/Probes
DAPI (dilactate) is a blue fluorescent dye that preferentially binds dsDNA and binds to minor groove AT clusters. DAPI (dilactate) is combined with dsDNA, and the fluorescence was enhanced about 20-fold. DAPI (dilactate) can be used to identify the cell cycle and specifically stains the nucleus but not the cytoplasm. DAPI (dilactate) form is more soluble in water than DAPI (dihydrochloride) form.

HY-D1491

Fast Red Violet LB	Dyes
Fast Red Violet LB is a dye for staining tartrate resistant acid phosphatase (TRAP). Fast Red Violet LB can be used for alkaline phosphatase (ALP) activity staining .

Cat. No.	Product Name	Category	Target	Chemical Structure

HY-W015851

*(R)-3-Hydroxybutanoic* acid sodium** 5 Publications Verification (R)-(-)-3-Hydroxybutanoic acid sodium; (R)-3-Hydroxybutyric acid sodium	Structural Classification Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Endogenous Metabolite
(R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .

HY-W051723

*(R)-3-Hydroxybutanoic* acid** 5 Publications Verification (R)-(-)-3-Hydroxybutanoic acid; (R)-3-Hydroxybutyric acid	Structural Classification Classification of Application Fields Anti-aging Source classification Endocrine diseases Endogenous metabolite Immune System Disorder Ketones, Aldehydes, Acids Disease markers Other Diseases Nervous System Disorder Disease Research Fields Cardiovascular System Disorder	Endogenous Metabolite
(R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones .

HY-105055

Didemnin B	Structural Classification Natural Products Animals Classification of Application Fields Marine natural products Source classification Other marine organisms Disease Research Fields Cancer	Others
Didemnin B is a depsipeptide extracted from the marine tunicate Trididemnin cyanophorum. Didemnin B can be used for the research of cancer .

HY-W015424

N-Methyl-DL-glutamic acid 1 Publications Verification	Structural Classification Natural Products Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite
N-Methyl-DL-glutamic acid is a L-Glutamic acid (HY-14608) analog with cytotoxic effects .

HY-30216AR

Leucic acid (Standard) α-Hydroxyisocaproic acid (Standard)	Structural Classification Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Endogenous Metabolite Reference Standards
Leucic acid (Standard) is the analytical standard of Leucic acid. This product is intended for research and analytical applications. Leucic acid is an amino acid metabolite .

HY-30216A

Leucic acid α-Hydroxyisocaproic acid	Structural Classification Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite
Leucic acid is an amino acid metabolite .

HY-W015851R

*(R)-3-Hydroxybutanoic* acid sodium (Standard)** (R)-(-)-3-Hydroxybutanoic acid sodium (Standard); (R)-3-Hydroxybutyric acid sodium (Standard)	Structural Classification Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Reference Standards Endogenous Metabolite
(R)-3-Hydroxybutanoic acid (sodium) (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid (sodium). This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones[1][2].

HY-W051723R

*(R)-3-Hydroxybutanoic* acid (Standard)** (R)-(-)-3-Hydroxybutanoic acid (Standard); (R)-3-Hydroxybutyric acid (Standard)	Structural Classification Immune System Disorder Ketones, Aldehydes, Acids Source classification Disease markers Endocrine diseases Nervous System Disorder Endogenous metabolite Cardiovascular System Disorder	Reference Standards Endogenous Metabolite
(R)-3-Hydroxybutanoic acid (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid. This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones[1][2].

HY-W015424R

N-Methyl-DL-glutamic acid (Standard)	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite
N-Methyl-DL-glutamic acid is a L-Glutamic acid (HY-14608) analog with cytotoxic effects .

HY-N9140

Hulupinic acid	Structural Classification Natural Products Humulus lupulus L. Source classification Plants Moraceae	Others
Hulupinic acid is a prominent oxidation product of hop acids .

HY-N11420

Coronatine	Structural Classification Microorganisms Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Disease Research Fields Agricultural Research	Bacterial Phytohormone
Coronatine is a plant growth regulator that mimicks the jasmonic acid-isoleucine conjugate (JA-Ile), targets the jasmonic acid receptor COI1, activates the jasmonic acid signaling pathway, thereby inhibiting salicylic acid (SA)-dependent defense responses. Coronatine antagonizes the stomatal closure, induces plant cell necrosis and chlorosis, interfers with plant hormone balance, thereby promoting pathogen infection ^[3] .

HY-20897A

5-Bromo-L-tryptophan 1 Publications Verification	Structural Classification Natural Products Classification of Application Fields Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite
5-Bromo-L-tryptophan is an α-amino acid derivative that can be found in Semenospongia sp. .

HY-20897AR

5-Bromo-L-tryptophan (Standard)	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite
5-Bromo-L-tryptophan (Standard) is the analytical standard of 5-Bromo-L-tryptophan. This product is intended for research and analytical applications. 5-Bromo-L-tryptophan is an α-amino acid derivative that can be found in Semenospongia sp. .

HY-W399297

Isodeoxycholic acid 1 Publications Verification 7α,12α-Dihydroxycholanoic acid	Structural Classification Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields Steroids	Endogenous Metabolite
Isodeoxycholic acid (7α,12α-Dihydroxycholanoic acid) is the 3β-epimer of ursodeoxycholic acid. Isodeoxycholic acid has the effect on choleresis and liver biochemistry .

HY-W399297R

Isodeoxycholic acid (Standard) 7α,12α-Dihydroxycholanoic acid (Standard)	Structural Classification Source classification Endogenous metabolite Steroids	Endogenous Metabolite Reference Standards
Amprenavir (Standard) is the analytical standard of Amprenavir. This product is intended for research and analytical applications. Amprenavir (VX-478) is a HIV protease inhibitor (Ki=0.6 nM) used to treat HIV infection. Amprenavir is also a SARS-CoV 3CLpro inhibitor with an IC50 of 1.09 μM.

HY-N8268R

Nordeoxycholic acid (Standard) 3α,12α-Dihydroxynorcholanic acid (Standard)	Animals Source classification	Drug Metabolite Reference Standards
Reproterol (hydrochloride) (Standard) is the analytical standard of Reproterol (hydrochloride). This product is intended for research and analytical applications. Reproterol hydrochloride is a dual-acting beta2-adrenoceptor agonist and phosphodiesterase inhibitor. Reproterol hydrochloride is more potent than albuterol and feterol in stimulating cAMP production in human monocytes, demonstrating its potential in enhancing airway function. Furthermore, Reproterol significantly inhibited the production of LTB4, indicating its anti-inflammatory properties. Reproterol hydrochloride may have inhibitory effects in respiratory diseases such as asthma and COPD .

HY-W751418

N-Nervonoyl taurine (Z)-2-tetracos-15-enamidoethanesulfonic acid	Structural Classification Natural Products Source classification Endogenous metabolite	FAAH
N-Nervonoyl taurine ((Z)-2-tetracos-15-enamidoethanesulfonic acid) is a fatty acid-taurine conjugate derived from nervonic acid. N-Nervonoyl taurine is a substrate of fatty acid amide hydrolase (FAAH) discovered during metabolite profiling .

HY-W013214

Ethyl arachidonate	Structural Classification Natural Products Source classification Endogenous metabolite	Endogenous Metabolite
Ethyl arachidonate is a lipophilic esterified form of arachidonic acid (AA) and can be added into dietary regimens or fed to cultured cells as a source of exogenous arachidonate. Ethyl arachidonate is the main species of fatty acid ethyl esters (FAEE) in brain of alcohol-intoxicated subjects .

HY-N8268

Nordeoxycholic acid 3α,12α-Dihydroxynorcholanic acid	Animals Source classification	Others
Nordeoxycholic acid is a 23-carbon bile acid. Nordeoxycholic acid is a norcholic acid metabolite and a steroid human metabolite .

HY-N15317

Phocaecholic acid β-Phocaecholic acid	Structural Classification Animals Ketones, Aldehydes, Acids Source classification	Drug Metabolite
Phocaecholic acid (β-Phocaecholic acid) is a bile acid found in duck bile. Phocaecholic acid can be excreted into bile and partially decarboxylated to nor-chenodeoxycholic acid in rats. Phocaecholic acid is promising for research of bile acid metabolism and related diseases .

HY-N0169B

Murideoxycholic acid 1 Publications Verification	Structural Classification Animals Classification of Application Fields Source classification Metabolic Disease Disease Research Fields Steroids	Endogenous Metabolite
Murideoxycholic acid is a 6 beta-hydroxylated bile acid .

HY-N11909

8-O-4,8-O-4-Dehydrotriferulic acid	Structural Classification Zea mays L. Ketones, Aldehydes, Acids Gramineae Source classification Plants	Others
8-O-4,8-O-4-Dehydrotriferulic acid is a dehydrotriferulic acid that can be isolated from saponified corn bran insoluble fiber .

HY-N8500

Aristolochic acid Ia	Structural Classification Natural Products Aristolochia debilis Sieb. et Zucc. Source classification Plants Aristolochiaceae	Drug Metabolite
Aristolochic acid Ia is an oxidative metabolite of aristolochic acid I, which can be used to study the detoxification pathway of aristolochic acid metabolism .

HY-112653A

(±)8-HETE 8-Hydroxy-5(Z),9(E),11(Z),14(Z)-eicosatetraenoic acid	Structural Classification Classification of Application Fields Ketones, Aldehydes, Acids Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
(±)8-HETE is one of the six monohydroxy fatty acids produced by the non-enzymatic oxidation of Arachidonic acid (HY-109590). The biological activity of (±)8-HETE is likely to resemble that of its constituent enantiomers (8(R)-HETE and 8(S)-HETE).

HY-W051164

5-Hydroxyvanillin	Infection Structural Classification Classification of Application Fields Source classification Phenols Polyphenols Endogenous metabolite Disease Research Fields	Endogenous Metabolite
5-Hydroxyvanillin is the product of the bacterial and fungal breakdown of ferulic acid, an abundant component in cell walls of found in many seed and leaves .

HY-N6072

Seco-neokadsuranic acid A	Triterpenes Structural Classification Ketones, Aldehydes, Acids Terpenoids Source classification Plants Kadsura coccinea (Lem.) A. C. Smith Schisandraceae	Others
Seco-neokadsuranic acid A is a triterpene acid isolated from Kadsura coccinea .

HY-W747583

Apocholic acid	Triterpenes Structural Classification Terpenoids Source classification Endogenous metabolite	Endogenous Metabolite
Apocholic acid, a Bile acid, is an endogenous metabolite .

HY-157732

1,2-Dimyristoyl-3-palmitoyl-rac-glycerol	Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
1,2-Dimyristoyl-3-palmitoyl-rac-glycerol (MMP) is a triacylglycerol that contains myristic acid and palmitic acid .

HY-W403933R

12-Ketochenodeoxycholic acid (Standard)	Structural Classification Human Gut Microbiota Metabolites Microorganisms Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Autophagy Reference Standards
Afatinib (Standard) is the analytical standard of Afatinib. This product is intended for research and analytical applications. Afatinib (BIBW 2992) is an orally active, potent and irreversible dual specificity inhibitor of ErbB family (EGFR and HER2), with IC50 values of 0.5 nM, 0.4 nM, 10 nM and 14 nM for EGFRwt, EGFRL858R, EGFRL858R/T790M and HER2, respectively. Afatinib can be used for the research of esophageal squamous cell carcinoma (ESCC), non-small cell lung cancer (NSCLC) and gastric cancer ^[3] .

HY-113120

Stearidonic acid 6Z,9Z,12Z,15Z-Octadecatetraenoic acid	Structural Classification Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Endogenous metabolite Disease Research Fields	Endogenous Metabolite
Stearidonic acid (6Z,9Z,12Z,15Z-Octadecatetraenoic acid) is an intermediate fatty acid in the biosynthetic pathway from α-linolenic acid to VLC ω-3 PUFA. The conversion efficiency of stearidonic acid is higher than that of alpha-linolenic acid. Increasing the intake of stearidonic acid can increase the content of eicosapentaenoic acid (EPA) in red blood cells. Stearidonic acid can also be isolated from methanolic extracts of the brown alga Brachyphyllum gracilis .

HY-W403933

12-Ketochenodeoxycholic acid	Structural Classification Human Gut Microbiota Metabolites Microorganisms Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Autophagy
12-Ketochenodeoxycholic acid 12 is a direct precursor of cholodeoxycholic acid (CDCA). Cholodeoxycholic acid is used to cholesterol gallstones and has chemotherapeutic properties that dissolve gallstones .

HY-116688

*2-Hydroxy-4-(methylthio)butyric acid*	Structural Classification Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Bacterial
2-Hydroxy-4-(methylthio)butyric acid is a dietary essential amino acid which is converted to Methionine (HY-13694) by 2-hydroxy acid dehydrogenase and 2-hydroxy acid oxidase. 2-Hydroxy-4-(methylthio)butyric acid is promising for research of gut disease .

HY-N7856

3-Oxooctadecanoic acid 3-Oxostearic acid	Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Endogenous metabolite Disease Research Fields	Others
3-Oxooctadecanoic acid (3-Oxostearic acid) is a saturated fatty acid (SFA). 3-Oxooctadecanoic acid is an intermediate product in fatty acid biosynthesis and it was converted from malonic acid via the enzyme .

HY-N0593

Deoxycholic acid 15+ Cited Publications Cholanoic acid; Desoxycholic acid	Structural Classification Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields Steroids	G protein-coupled Bile Acid Receptor 1 Endogenous Metabolite
Deoxycholic acid (cholanoic acid), a bile acid, is a by-product of intestinal metabolism, that activates the G protein-coupled bile acid receptorTGR5 .

HY-N2855

Alphitolic acid 1 Publications Verification Aophitolic acid	Triterpenes Source classification Myrica nagi Plants Myricaceae	Apoptosis Autophagy TNF Receptor Akt NF-κB
Alphitolic acid (Aophitolic acid) is an anti-inflammatory triterpene could found in quercus aliena. Alphitolic acid blocks Akt–NF-κB signaling to induce apoptosis. Alphitolic acid induces autophagy. Alphitolic acid has anti-inflammatory activity and down-regulates the NO and TNF-α production. Alphitolic acid can be used for cancer and inflammation research ^[3].

HY-N1652

2,3,8-Tri-O-methylellagic acid 3,3′,4-Tri-O-methylellagic acid	Monophenols Classification of Application Fields Neoboutonia macrocalyx Pax Source classification Other Diseases Phenols Euphorbiaceae Plants Disease Research Fields	Others
2,3,8-Tri-O-methylellagic acid is a terpenoids that can be isolated from the stem bark of Neoboutonia macrocalyx. 2,3,8-Tri-O-methylellagic acid is found to be 50 times more active than the parent ellagic acid .

HY-N0593A

Deoxycholic acid sodium salt 15+ Cited Publications Sodium deoxycholate	Structural Classification Microorganisms Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields Steroids	G protein-coupled Bile Acid Receptor 1 Endogenous Metabolite
Deoxycholic acid sodium salt (sodium deoxycholate), a bile acid, is a by-product of intestinal metabolism, that activates the G protein-coupled bile acid receptorTGR5 .

HY-N0593R

Deoxycholic acid (Standard) 15+ Cited Publications Cholanoic acid(Standard); Desoxycholic acid (Standard)	Structural Classification Human Gut Microbiota Metabolites Microorganisms Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields Steroids	Reference Standards G protein-coupled Bile Acid Receptor 1 Endogenous Metabolite
Deoxycholic acid (Standard) is the analytical standard of Deoxycholic acid. This product is intended for research and analytical applications. Deoxycholic acid (cholanoic acid), a bile acid, is a by-product of intestinal metabolism, that activates the G protein-coupled bile acid receptorTGR5 .

HY-N15885

12-NBD Stearate	Structural Classification Lipid	Fluorescent Dye FABP Phosphatase
12-NBD Stearate is a fluorescent fatty acid analogue. 12-NBD Stearate binds to fatty acid binding protein (FABP) and sterol carrier protein-2 (SCP-2). Overexpressing sterol carrier protein-2 (SCP-2) 15-kDa isoform enhances 12-NBD Stearate transport. 12-NBD Stearate is a tool for microscopic long chain fatty acids (LCFA) uptake and internalization studies ^[3].

HY-N0593AR

Deoxycholic acid sodium salt (Standard) Sodium deoxycholate (Standard)	Structural Classification Microorganisms Source classification Endogenous metabolite Steroids	G protein-coupled Bile Acid Receptor 1 Endogenous Metabolite
Deoxycholic acid sodium salt (Standard) is the analytical standard of Deoxycholic acid sodium salt. This product is intended for research and analytical applications. Deoxycholic acid sodium salt (sodium deoxycholate), a bile acid, is a by-product of intestinal metabolism, that activates the G protein-coupled bile acid receptorTGR5 .

HY-141540

Lactyl-CoA 3 Publications Verification	Microorganisms Source classification	Biochemical Assay Reagents Endogenous Metabolite
Lactyl-CoA is an acyl-CoA formally condensed from the sulfhydryl group of CoA and the carboxyl group of lactic acid, also known as lactyl-CoA. Lactyl-CoA is essential for the biosynthesis of biodegradable and biocompatible lactic acid-based copolymers .

HY-N7813

1,2-Dipalmitoyl-3-oleoylglycerol	Natural Products Classification of Application Fields Source classification Sterculiaceae Theobroma cacao Linn. Other Diseases Plants Disease Research Fields	Others
1,2-Dipalmitoyl-3-oleoylglycerol, a major P-containing triacylglycerol, can be found in palm oil, palm stearin, cocoa butter, and lard .

HY-Y0507R

DL-Serine (Standard)	Structural Classification other families Ketones, Aldehydes, Acids Source classification Plants	Reference Standards TMV
DL-Serine (Standard) is the analytical standard of DL-Serine. This product is intended for research and analytical applications. DL-Serine, a fundamental metabolite, is a mixture of D-Serine and L-Serine. DL-Serine has antiviral activity against the multiplication of tobacco mosaic virus (TMV)[1].

HY-N12350

Ellagic acid 3-O-α-L-rhamnopyranoside	Structural Classification Flavonoids Staphyleaceae Source classification Plants Biflavones Turpinia arguta (Lindl.) Seem.	Others
Ellagic acid 3-O-α-L-rhamnopyranoside is an ellagic acid derivative can be isolated from Folium Turpiniae .

HY-N3894

Ferulamide	Alkaloids Monophenols Source classification Phenols Plants Umbelliferae Carphephorus corymbosus (Nutt.) Torr. & A.Gray	nAChR
Ferulamide is a Ferulic acid derivative isolated from Portulaca oleracea L. with anticholinesterase activities .

HY-157735

2-Myristyldipalmitin	Structural Classification Natural Products Classification of Application Fields Source classification Metabolic Disease Endogenous metabolite Disease Research Fields	Endogenous Metabolite
2-Myristyl dipalmitin (PMP) is a triglyceride of palmitic acid. 2-Myristyldipalmitin has potential as a lipid marker for Wilson's disease (WD) .

HY-N7880

Salvianolic acid Y	Structural Classification Classification of Application Fields Simple Phenylpropanols Labiatae Samanea saman (Jacq.) Merr. Source classification Phenols Polyphenols Phenylpropanoids Plants Disease Research Fields Cancer	Reactive Oxygen Species (ROS)
Salvianolic acid Y is a phenolic acid with the same planar structure as Salvianolic acid B. Salvianolic acid Y rescues cell injury by H₂O₂ .

HY-W012922

2-Methyl-4-pentenoic Acid 2-Methylpent-4-enoic acid	Structural Classification other families Classification of Application Fields Ketones, Aldehydes, Acids Source classification Other Diseases Plants Disease Research Fields	Drug Intermediate
2-Methyl-4-pentenoic Acid (2-Methylpent-4-enoic acid) is an organic acid that can be used as a precursor for synthesizing other compounds. Additionally, changes in the level of 2-Methyl-4-pentenoic Acid may be associated with the susceptibility to schizophrenia and type 2 diabetes .

HY-W011819R

Tetradecanedioic acid (Standard)	Structural Classification Ketones, Aldehydes, Acids Source classification Endogenous metabolite	Reference Standards Endogenous Metabolite
Tetradecanedioic acid (Standard) is the analytical standard of Tetradecanedioic acid. This product is intended for research and analytical applications. Tetradecanedioic acid is an endogenous metabolite and belongs to the class of organic compounds known as long-chain fatty acids. Tetradecanedioic acid is an endogenous biomarker for assessing the activity of organic anion transporting polypeptides (OATPs) .

HY-N15829

Cholyl-Lys-fluorescein sodium	Structural Classification Lipid	Fluorescent Dye
Cholyl-Lys-fluorescein sodium is a fluorescein-labeled bile acid analog. Cholyl-Lys-fluorescein sodium can be used for biliary atresia validation and for determining in vivo liver function .

Cat. No.	Product Name	Chemical Structure

HY-W015851S2

*(R)-3-Hydroxybutanoic* acid-13C4 sodium**
(R)-3-Hydroxybutanoic acid- ¹³C₄ sodium is a ¹³C labeled (R)-3-Hydroxybutanoic acid (HY-W051723). (R)-3-Hydroxybutanoic acid is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .

HY-B0228S10

*(R)-3-Hydroxybutanoic* acid-13C2 sodium**
(R)-3-Hydroxybutanoic acid- ¹³C₂ sodium is the ¹³C labeled (R)-3-Hydroxybutanoic acid sodium (HY-W015851). (R)-3-Hydroxybutanoic acid sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones ^[3].

HY-W654002

(3R)-3-Hydroxybutyric acid-1-13C
(3R)-3-Hydroxybutyric acid-1- ¹³C is ¹³C labeled (R)-3-Hydroxybutanoic acid. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones ^[3].

HY-P0014S2

Liraglutide-13C6,15N TFA
Liraglutide- ¹³C₆, ¹⁵N (TFA)is the ¹³C and ¹⁵N labeledLiraglutide(HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .

HY-P0014S1

Liraglutide-13C5,15N TFA
Liraglutide- ¹³C₅, ¹⁵N (tetraTFA) is the ¹³C and ¹⁵N labeled Liraglutide (HY-P0014) . Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .

HY-I1124

L-Valine-d8 1 Publications Verification
L-Valine-d₈ is a deuterated form of L-Valine. L-Valine-d₈ can be used in the labelled synthesis of L-valineamide-d8 intermediate . L-Valine is one of 20 proteinogenic amino acids. L-Valine is an essential amino acid .

HY-106579S

Tiaprofenic acid-d3
Tiaprofenic acid-d₃ is a deuterium labeled Tiaprofenic acid. Tiaprofenic acid is a nonsteroidal anti-inflammatory agent (NSAID) mainly used in the treatment of rheumatic diseases .

HY-P0014AS

Liraglutide-d8 tetraTFA
Liraglutide-d₈ tetraTFA is deuterium labeled Liraglutide (HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used for the study of type 2 diabetes mellitus .

HY-I1124R

L-Valine-d8 (Standard)
L-Valine-d8 (Standard) is the analytical standard of L-Valine-d8. This product is intended for research and analytical applications. L-Valine-d8 is a deuterated form of L-Valine. L-Valine-d8 can be used in the labelled synthesis of L-valineamide-d8 intermediate . L-Valine is one of 20 proteinogenic amino acids. L-Valine is an essential amino acid .

HY-I1111S

Fmoc-L-Val-OH-d8
Fmoc-L-Val-OH-d₈ is a deuterium labeled Fmoc-L-Val-OH (HY-I1111). Fmoc-L-Val-OH is a kind of protect amino acids . Fmoc-L-Val-OH-1- ¹³C 是一种 ¹³C 标记的 Fmoc-L-Val-OH (HY-I1111)。 Fmoc-L-Val-OH 是一种缬氨酸衍生物。

HY-W018392S

Mono-(2-ethylhexyl) phthalate-d4

Mono-(2-ethylhexyl) phthalate-d₄ is a deuterium labeled Mono-(2-ethylhexyl) phthalate (HY-W018392). Mono-(2-ethylhexyl) phthalate (MEHP) is a major bioactive metabolite of diethylhexyl phthalate (DEHP). Mono-(2-ethylhexyl) phthalate can promote fatty acid synthesis in hepatocytes by regulating the expression of relevant genes and proteins, contributing to non-alcoholic fatty liver disease (NAFLD) .

HY-B0167S1

Salicylic acid-13C6
Salicylic acid- ¹³C₆ is the ¹³C-labeled Salicylic acid (HY-B0167). Salicylic acid is a precursor to and a metabolite of Aspirin (HY-14654), can inhibit cyclo-oxygenase-2 (COX-2) activity .

HY-17623S

Tegoprazan-d6

Tegoprazan (CJ-12420; RQ-00000004), a potassium-competitive acid blocker, is a reversible, oral active and highly selective inhibitor of gastric H+/K+-ATPase that could control gastric acid secretion and motility, with IC₅₀ values ranging from 0.29-0.52 μM for porcine, canine, and human H ⁺/K ⁺-ATPases in vitro. Tegoprazan significantly improves colitis in mice and enhances the intestinal epithelial barrier function. Tegoprazan is promising for research of Inflammatory bowel, gastric acid-related, motilityimpaired diseases ^[3].

HY-D2283S1

Photo-lysine-d2
Photo-lysine-d₂ is the deuterium labeled Photo-lysine. Photo-lysine is a DL-lysine-based photo-reactive amino acid, captures proteins that bind lysine post-translational modifications .

HY-144026S

9-PAHSA-d9
9-PAHSA-d9 is the deuterium labeled 9-PAHSA (HY-120657). 9-PAHSA, an endogenous fatty acid, reduces blood glucose levels and attenuates inflammation .

HY-D2283S2

Photo-lysine-d2-1
Photo-lysine-d₂-1 is the deuterium labeled Photo-lysine. Photo-lysine is a DL-lysine-based photo-reactive amino acid, captures proteins that bind lysine post-translational modifications .

HY-N0667S7

L-Asparagine-13C4,15N2

L-Asparagine- ¹³C₄, ¹⁵N₂ ((-)-Asparagine- ¹³C₄, ¹⁵N₂) is the ¹³C and ¹⁵N-labeled L-Asparagine (HY-N0667). L-Asparagine is an essential amino acid for leukemic cells and a substrate for L-Asparaginase. L-Asparaginase is a potent anti-leukemic enzyme that promotes asparagine (Asn) and glutamine (Gln) depletion and inhibits protein biosynthesis in lymphoblasts. Removal of L-asparagine from plasma by L-Asparaginase results in inhibition of RNA and DNA synthesis and subsequent apoptosis. L-Asparaginase has cell-killing ability in vitro and in vivo, and selectively inhibits the growth of cancer cells with low asparagine synthetase (AASNS) expression. L-Asparagine can be used as a biomarker and sensor for the study of childhood acute lymphoblastic leukemia ^[3] .

HY-D2283S

Photo-DL-lysine-d2
Photo-DL-lysine-d₂ is the deuterium labeled Photo-DL-lysine (HY-D2283). Photo-DL-lysine is a DL-lysine-based photo-reactive amino acid, captures proteins that bind lysine post-translational modifications .

HY-W009362S

DL-Isocitric acid-13C4 trisodium salt
DL-Isocitric acid- ¹³C₄ (trisodium salt) is a ¹³C labeled DL-Isocitric acid (trisodium salt) (HY-W009362). DL-Isocitric acid trisodium salt is an endogenous metabolite. DL-Isocitric acid trisodium salt is a substrate in the citric acid cycle. DL-Isocitric acid trisodium salt can be used as a marker for determining the composition of isocitrates in fruit products, including fruit juices.

HY-100807S2

Quinolinic acid-13C4,15N
Quinolinic acid-13C4, 15N is an isotopic labeled Quinolinic acid (HY-100807). Quinolinic acid is an endogenous N-methyl-D-aspartate (NMDA) receptor agonist and has the potential of mediating NMDA neuronal damage and dysfunction .

HY-116374S

Glycolithocholic acid-d4
Glycolithocholic acid-d₄ is the deuterium labeled Glycolithocholic acid. Glycolithocholic acid, an endogenous metabolite, is a glycine-conjugated secondary bile acid and can be used to diagnose ulcerative colitis (UC), non-alcoholic steatohepatitis (NASH) and primary sclerosing cholangitis (PSC) ^[3] .

HY-138616S1

dGTP-d14 dilithium
dGTP-d₁₄ (2'-Deoxyguanosine-5'-triphosphate-d₁₄) dilithium is deuterium labeled dGTP (HY-138616). dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP.

HY-138616S4

dGTP-13C10,15N5 dilithium

dGTP- ¹³C₁₀, ¹⁵N₅ (2'-Deoxyguanosine-5'-triphosphate- ¹³C₁₀, ¹⁵N₅) dilithium is ¹³C and ¹⁵N-labeled dGTP (HY-138616). dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP.

HY-111095S1

D-(-)-Lactic acid-13C
D-(-)-Lactic acid-13C ((R)-2-Hydroxypropionic acid-13C) is a ¹³C-labeled D-Lactic acid. D-(-)-Lactic acid-13C can be used as an internal standard and can also be used in studies such as metabolic tracing.

HY-B0172S

Lithocholic acid-d4 1 Publications Verification
Lithocholic acid-d₄ is the deuterium labeled Lithocholic acid, which is a toxic secondary bile acid .

HY-138616S3

dGTP-13C10 dilithium
dGTP- ¹³C₁₀ (2'-Deoxyguanosine-5'-triphosphate- ¹³C₁₀) dilithium is ¹³C-labeled dGTP (HY-138616). dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP.

HY-B0946S

Sulfamonomethoxine-d4
Sulfamonomethoxine-d₄ is a deuterium labeled Sulfamonomethoxine (HY-B0946). Sulfamonomethoxine is an orally active sulfonamide antibiotic for veterinary use. Sulfamonomethoxine is also an inhibitor of dihydropteroate synthetase, which can block the synthesis of folic acid. Sulfamonomethoxine has antibacterial activity .

HY-138616S

dGTP-15N5 dilithium
dGTP- ¹⁵N₅ (2'-Deoxyguanosine-5'-triphosphate- ¹⁵N₅) dilithium is ¹⁵N labeled dGTP (HY-138616). dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP.

HY-N0216S

Benzoic acid-d5 1 Publications Verification
Benzoic acid-d₅ is a deuterium substitute for Benzoic acid. Benzoic acid is an aromatic alcohol that occurs naturally in many plants and is a common additive in food, beverages, cosmetics and other products. Benzoic acid can act as a preservative by inhibiting bacteria and fungi .

HY-138616S2

dGTP-15N5,d14 dilithium

dGTP- ¹⁵N₅,d₁₄ (2'-Deoxyguanosine-5'-triphosphate- ¹⁵N₅,d₁₄) dilithium is deuterium and ¹⁵N labeled dGTP (HY-138616). dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP.

HY-W050026S

Phenylacetylglutamine-d5 2 Publications Verification
Phenylacetylglutamine-d₅ (NSC 203800-d₅) is the deuterium labeled Phenylacetylglutamine (HY-W050026). Phenylacetylglutamine is a colonic microbial metabolite from amino acid fermentation .

HY-N0121S

Sesamin-d8
Sesamin-d8 is the deuterium labeled Sesamin (HY-N0121). Sesamin, abundant lignan found in sesame oil, is a potent and selective delta 5 desaturase inhibitor in polyunsaturated fatty acid biosynthesis. Sesamin exerts effective neuroprotection against cerbral ischemia .

HY-N7063S1

Nerol-d6
Nerol-d₆ is deuterated labeled Nerol (HY-N7063). Nerol is a constituent of neroli oil. Nerol Nerol triggers mitochondrial dysfunction and induces apoptosis via elevation of Ca2+ and ROS. Antifungal activity .

HY-W004260S

Arachidic acid-d2
Arachidic acid-d₂ is the deuterium labeled Arachidic acid (HY-W004260). Arachidic acid (Eicosanoic acid) is a long-chain saturated fatty acid. Arachidic acid can be found in the human organism from the plasma phospholipid, fish, cannabis and other plant oils. Arachidic acid conjugated with Chitosan oligosaccharide (HY-112108) can be used for anti-cancer drug delivery research ^[3].

HY-W004260S5

Arachidic acid-d4-1
Arachidic acid-d₄-1 is the deuterium labeled Arachidic acid (HY-W004260). Arachidic acid (Eicosanoic acid) is a long-chain saturated fatty acid. Arachidic acid can be found in the human organism from the plasma phospholipid, fish, cannabis and other plant oils. Arachidic acid conjugated with Chitosan oligosaccharide (HY-112108) can be used for anti-cancer drug delivery research ^[3].

HY-W004260S2

Arachidic acid-d3
Arachidic acid-d₃ is the deuterium labeled Arachidic acid (HY-W004260). Arachidic acid (Eicosanoic acid) is a long-chain saturated fatty acid. Arachidic acid can be found in the human organism from the plasma phospholipid, fish, cannabis and other plant oils. Arachidic acid conjugated with Chitosan oligosaccharide (HY-112108) can be used for anti-cancer drug delivery research ^[3].

HY-W004260S4

Arachidic acid-d4
Arachidic acid-d₄ is the deuterium labeled Arachidic acid (HY-W004260). Arachidic acid (Eicosanoic acid) is a long-chain saturated fatty acid. Arachidic acid can be found in the human organism from the plasma phospholipid, fish, cannabis and other plant oils. Arachidic acid conjugated with Chitosan oligosaccharide (HY-112108) can be used for anti-cancer drug delivery research ^[3].

HY-W004260S1

Arachidic acid-d39
Arachidic acid-d₃₉ is the deuterium labeled Arachidic acid (HY-W004260). Arachidic acid (Eicosanoic acid) is a long-chain saturated fatty acid. Arachidic acid can be found in the human organism from the plasma phospholipid, fish, cannabis and other plant oils. Arachidic acid conjugated with Chitosan oligosaccharide (HY-112108) can be used for anti-cancer drug delivery research ^[3].

HY-B0007S2

Baclofen-d5 hydrochloride

Baclofen-d₅ hydrochloride is deuterated labeled Baclofen (HY-B0007). Baclofen, a lipophilic derivative of γ-aminobutyric acid (GABA), is an orally active, selective metabotropic GABA_B receptor (GABA_BR) agonist. Baclofen mimics the action of GABA and produces slow presynaptic inhibition through the GABA_B receptor. Baclofen has high blood brain barrier penetrance. Baclofen has the potential for muscle spasticity research ^[3].

HY-B0007S

Baclofen-d4

Baclofen-d₄ is the deuterium labeled Baclofen. Baclofen, a lipophilic derivative of γ-aminobutyric acid (GABA), is an orally active, selective metabotropic GABAB receptor (GABABR) agonist. Baclofen mimics the action of GABA and produces slow presynaptic inhibition through the GABAB receptor. Baclofen has high blood brain barrier penetrance. Baclofen has the potential for muscle spasticity research ^[3].

HY-125818S3

Cytidine-5'-triphosphate-13C9 dilithium

Cytidine-5'-triphosphate- ¹³C₉ (Cytidine triphosphate- ¹³C₉ dilithium; 5'-CTP- ¹³C₉) dilithium is ¹³C-labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii.

HY-125818S2

Cytidine-5'-triphosphate-13C,d1 dilithium

Cytidine-5'-triphosphate- ¹³C,d₁ (Cytidine triphosphate- ¹³C,d₁ dilithium; 5'-CTP- ¹³C,d₁) dilithium is deuterium and ¹³C-labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii.

HY-125818S5

Cytidine-5'-triphosphate-15N3,d14 dilithium

Cytidine-5'-triphosphate- ¹⁵N₃,d₁₄ (Cytidine triphosphate- ¹⁵N₃,d₁₄ dilithium; 5'-CTP- ¹⁵N₃,d₁₄) dilithium is deuterium and ¹⁵N labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii.

HY-125818S6

Cytidine-5'-triphosphate-15N3 dilithium

Cytidine-5'-triphosphate- ¹⁵N₃ (Cytidine triphosphate- ¹⁵N₃ dilithium; 5'-CTP- ¹⁵N₃) dilithium is ¹⁵N labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii.

HY-125818S4

Cytidine-5'-triphosphate-d14 dilithium

Cytidine-5'-triphosphate-d₁₄ (Cytidine triphosphate-d₁₄ dilithium; 5'-CTP-d₁₄) dilithium is deuterium labeled Cytidine-5'-triphosphate (HY-125818). Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii.

Cat. No.	Product Name		Classification

HY-132582A

*Tau ASO-12 (murine) (sodium)*		Antisense Oligonucleotides
Tau ^ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ^ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )

HY-132609

Patisiran sodium		siRNAs siRNA drugs
Patisiran sodium is a double-stranded small interfering RNA that targets a sequence within the transthyretin (TTR) messenger RNA. Patisiran sodium specifically inhibits hepatic synthesis of mutant and wild-type TTR. Patisiran sodium can be used for the research of hereditary TTR amyloidosis ^[3].

HY-132608

Inotersen sodium ISIS-420915 sodium		Antisense Oligonucleotides
Inotersen (ISIS-420915) sodium is a 2′-O-methoxyethyl-modified antisense oligonucleotide. Inotersen sodium inhibits the production of transthyretin (TTR) protein by targeting the TTR RNA transcript and reduces the levels of the TTR transcript. Inotersen sodium can be used for the research of hereditary TTR amyloidosis polyneuropathy ^[3].

HY-108764

Mipomersen sodium 1 Publications Verification ISIS 301012		Antisense Oligonucleotides
Mipomersen sodium (ISIS 301012) is an antisense oligonucleotide inhibitor of apolipoprotein B (apoB). Mipomersen has anti-HCV effect and reduces the infectivity of the HCV. Mipomersen sodium can be used for the research of homozygous familial hypercholesterolemia (HoFH) .

HY-145725

Baliforsen sodium IONIS 598769 sodium; ISIS 598769 sodium		Antisense Oligonucleotides
Baliforsen (sodium) is an antisense oligonucleotide (16 nucleotides) designed to target myotonic dystrophy protein kinase (DMPK) mRNA and research myotonic dystrophy.

HY-109561

Pegaptanib sodium EYE001; NX1838		Aptamers
Pegaptanib sodium is an RNA aptamer directed against vascular endothelial growth factor (VEGF)-165. Pegaptanib could be used for the study of neovascular age-related macular degeneration (AMD) .

HY-132613

Lumasiran sodium		siRNAs siRNA drugs
Lumasiran sodium, an investigational RNA interference (RNAi) therapeutic agent, reduces hepatic oxalate production by targeting glycolate oxidase. Lumasiran sodium reduces urinary oxalate excretion, the cause of progressive kidney failure in primary hyperoxaluria type 1 (PH1) .

HY-147080

Avacincaptad pegol sodium ARC1905		Aptamers
Avacincaptad pegol (ARC1905) sodium is a 40KDa PEG-conjugated aptamer. Avacincaptad pegol sodium targets complement factor 5 (C5), inhibits the cleavage of C5 into C5a and C5b, limits inflammatory stimulation and complement membrane attack complex (MAC), and is used to study age-related macular degeneration (AMD). Avacincaptad pegol sodium limits irregular cell apoptosis by targeting downstream factors in the complement cascade while preserving the early steps of the complement system. Avacincaptad pegol sodium treats Geographic atrophy (GA) mice ^[3] .

HY-145507

*1-Palmitoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium)* 1-Palmitoyl-2-hydroxy-sn-glycero-3-PG sodium; 16:0 Lyso PG; PG(16:0/0:0); 1-Hexadecanoyl-sn-glycero-3-phospho-(1'racglycerol) (sodium)		Phospholipids
1-Palmitoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (16:0 Lyso PE) sodium is a lysophospholipid containing palmitic acid (16:0) at the sn-1 position. It can be used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.

HY-145506

*1-Stearoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (sodium)* 18:0 Lyso PG sodium		Phospholipids
1-Stearoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (18:0 Lyso PE) sodium is a lysophospholipid containing stearic acid (18:0) at the sn-1 position. It can be used in the generation of micelles, liposomes, and other types of artificial membranes, including lipid-based drug carrier systems.

HY-N0593A

Deoxycholic acid sodium salt Maximum Cited Publications 20 Publications Verification Sodium deoxycholate		Emulsifiers
Deoxycholic acid sodium salt (sodium deoxycholate), a bile acid, is a by-product of intestinal metabolism, that activates the G protein-coupled bile acid receptorTGR5 .

HY-147320

3'-DMTr-dG(dmf)		Nucleoside Phosphoramidites Guanine
3'-DMTr-dG(dmf) is a guanosine derivative used in the synthesis of nucleic acids .

HY-W006429

L-Uridine		Nucleoside Analogs Uridine
L-Uridine is an enantiomer of the normal RNA constituent D-uridine. L-Uridine can be isolated from the Polyporaceae fungus Poria cocos (Schw.). L-uridine acts as a phosphate acceptor for nucleoside phosphotransferases .

HY-150017

2'-O-Methyl-5-methyl-U CEP		Nucleoside Phosphoramidites Uracil
2'-O-Methyl-5-methyl-U CEP is a uridine, can be used for synthesis nucleic acid.

HY-149156

Lipid C24		Cationic Lipids
Lipid C24 is a cationic ionizable lipid that can be used for synthesizing lipid nanoparticles. Lipid C24 can be used in the study of drug delivery .

HY-W243303E

Poly(acrylic acid) (MW 450000)		Polymers
Poly(acrylic acid) (MW 450000) is a polyacrylic acid with a molecular weight of 450000. Poly(acrylic acid) (MW 450000) is an anionic polymer. Poly(acrylic acid) (MW 450000) can be as a corrosion-mitigating and surface-stabilizing agent .

HY-157617

16:0 Cyclic LPA ammonium 1-Palmitoyl-sn-glycero-2,3-cyclic-phosphate ammonium		Phospholipids
16:0 Cyclic LPA (1-Palmitoyl-sn-glycero-2,3-cyclic-phosphate) ammonium is a palmitoyl cyclic phosphatidic acid .

HY-D0184

2'-Deoxycytidine 5+ Cited Publications Deoxycytidine; Cytosine deoxyriboside; Deoxyribose cytidine		Nucleoside Analogs Cytidine
2'-Deoxycytidine, a deoxyribonucleoside, can inhibit biological effects of Bromodeoxyuridine (Brdu). 2'-Deoxycytidine is essential for the synthesis of nucleic acids, that can be used for the research of cancer .

HY-W010970

5'-Guanylic acid disodium salt 2 Publications Verification 5'-GMP disodium salt; 5'-guanosine monophosphate disodium salt		Nucleotide Analogs
5'-Guanylic acid disodium salt is the disodium salt form of 5'-Guanylic acid (HY-N5134). 5'-Guanylic acid disodium salt is a purine nucleotide that participates in physiological processes such as energy metabolism, signal transduction, and gene expression regulation. 5'-Guanylic acid disodium salt regulates the expression of genes related to fatty acid metabolism. 5'-Guanylic acid disodium salt is the weak agonist for ionotropic glutamate receptors (iGluR), reduces the activity of the glutamatergic system and exhibits neuroprotective effect. 5'-Guanylic acid disodium salt also causes neuronal cell death at high concentrations ^[3].

HY-113437A

1,2-Dipalmitoyl-sn-glycerol 3-phosphate sodium 1 Publications Verification		Phospholipids
1,2-Dipalmitoyl-sn-glycerol 3-phosphate sodium (compound 3-F7) is a phosphatidic acid and a human endogenous metabolite . It is used in the generation of micelles, liposomes, and artificial membranes.

HY-112754A

DOTAP chloride 5+ Cited Publications 1,2-Dioleoyl-3-trimethylammonium-propane chloride		Cationic Lipids
DOTAP chloride is a useful and effective cationic lipid for transient and stable transfection DNA (plasmids, bacmids) and modified nucleic acids (antisense oligonucleotides) with out the use of helper lipid .

HY-143702

Fluorescent DOTAP NBD-DOTAP		Cationic Lipids
Fluorescent DOTAP (NBD-DOTAP) is a cationic lipid which can be used for nucleic acid and protein delivery. Fluorescent DOTAP is labeled with a fluorophore NBD (maximum excitation/emission wavelength ∼463/536 nm). Fluorescent DOTAP can be used for gene delivery systems, drug delivery, as well as cell imaging and nanocarrier tracking. Fluorescent DOTAP is an ideal candidate for both biological and pharmaceutical formulation (e.g. co-delivery of vaccines) research ^[3].

HY-154804

DLin-M-C4-DMA		Pegylated Lipids
DLin-M-C4-DMA (Compound MC4) is a cationic lipid. DLin-M-C4-DMA can be used for delivery of nucleic acids .

HY-W127433

Isostearic acid		Others
Isostearic acid is a unique fatty acid. Isostearic acid promotes IL-1 release and Apoptosis. Isostearic acid has potent inflammatory properties. Isostearic acid can be used in pharmaceutical, personal care, and cosmetic applications .

HY-110407

2'-O,4'-C-Methyleneadenosine LNA-A		Nucleoside Analogs Adenosine
2'-O,4'-C-Methyleneadenosine (LNA-A) is a locked nucleic acid (LNA) and is also an adenosine analog .

HY-B0172B

Isolithocholic acid		Cholesterol
Isolithocholic acid (β-Lithocholic acid) is an isomer of Lithocholic acid. Isolithocholic acid, a bile acid, is formed by microbial metabolism of Lithocholic acid or Lithocholic acid 3α-sulfate .

HY-46317

DMT-5Me-dC(Bz)-CE Phosphoramidite		Nucleoside Phosphoramidites Cytosine
DMT-5Me-dC(Bz)-CE Phosphoramidite is used in the preparation of locked nucleic acids (LNAs) for optimization of fluorescent oligonucleotide probes with improved spectral properties and target binding .

HY-W440827

DOPE-PEG-COOH (MW 2000) 1 Publications Verification		Pegylated Lipids
DOPE-PEG-COOH (MW 2000) is a PEG polymer containing unsaturated DOPE phospholipids and carboxylic acids. DOPE-PEG-COOH (MW 2000) can be used to prepare liposomes or other nanoparticles for drug delivery .

HY-172548

Docosahexaenoyl-L-carnitine chloride		Cationic Lipids
Docosahexaenoyl-L-carnitine chloride is a long-chain acylcarnitine composed of Docosahexaenoic acid (HY-B2167) and L-carnitine (HY-B0399). Docosahexaenoyl-L-carnitine chloride is transported into mitochondria for β -oxidation and decomposition under the action of carnitine palmitoyltransferase I (CPT I) and others. Docosahexaenoyl-L-carnitine chloride is promising for research of diseases related to fatty acid metabolism .

HY-138616

dGTP 2'-Deoxyguanosine-5'-triphosphate		Nucleotide Analogs
dGTP (2'-Deoxyguanosine-5'-triphosphate), a guanosine nucleotide, can be used in deoxyribonucleic acid synthesis. Guanosine nucleotides (GDP, GTP, dGDP, and dGTP) are highly susceptible to oxidative damage to 8-oxo-GDP (8-O-GDP), 8-O-dGTP, 8-O-GTP, and 8-O-dGTP .

HY-149037

GL67 N4-Spermine cholesteryl carbamate		Cationic Lipids
GL67 (N4-Spermine cholesteryl carbamate) is a cationic lipid. GL67 can be used for nucleic acid agents and vaccines delivery, and gene transfection .

HY-145225

DLin-K-C3-DMA		Cationic Lipids
DLin-K-C3-DMA, a cationic lipid, can be used in the synthesis of nucleic acid-lipid particle to delivery of nucleic acid .

HY-149037A

GL67 pentahydrochloride N4-Spermine cholesteryl carbamate pentahydrochloride		Cationic Lipids
GL67 (N4-Spermine cholesteryl carbamate) (pentahydrochloride) is a cationic lipid. GL67 can be used for nucleic acid agents and vaccines delivery, and gene transfection .

HY-132145

5-Propargylamino-ddUTP		Nucleotide Analogs
5-Propargylamino-ddUTP, a nucleoside molecule that can be used to synthesis of cyanine dye-nucleotide conjugate which is used in nucleic acid labeling or sequence analysis .

HY-141674

DMG-PEG		Pegylated Lipids
DMG-PEG is used for the preparation of liposome for siRNA delivery with improved transfection efficiency in vitro. DMG-PEG is also used for the lipid nanoparticle for an oral plasmid DNA delivery approach in vivo through a facile surface modification to improve the mucus permeability and delivery efficiency of the nanoparticles .

HY-132142

5-Propargylamino-dCTP		Nucleotide Analogs
5-Propargylamino-dCTP is a nucleoside molecule extracted from patent US9035035B2, compound dCTP-PA. 5-Propargylamino-dCTP can conjugate to molecular markers for use in nucleic acid labeling or sequence analysis . 5-Propargylamino-dCTP is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups.

HY-W441002

DSPE-succinic acid		Phospholipids
DSPE-succinic acid is a phophalipid capped with a carboxylic acid moiety. The carboxylic acid moiety is reactive with amine to from a stable amide linkage. DSPE-succinic acid can be used to prepare nanoparticles or liposomes for agent nanocarrier to deliver therapeutics .

HY-158709

Cho-es-Lys		Cholesterol
Cho-es-Lys is a cationic lipid synthesized by coupling natural cholesterol and amino acids, which has high gene transfection efficiency. Cho-es-Lys can be used in drug delivery research .

HY-147321

3'-DMTr-dG(iBu)		Nucleoside Analogs Guanosine
3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies .

HY-160439

Ionizable lipid-2		Cationic Lipids
Ionizable lipid-2 (Compound 1) is an ionizable lipid that can be used for the preparation of lipid nanoparticles and vaccine research .

HY-F0003A

NADPH tetracyclohexanamine 10+ Cited Publications		Nucleotide Analogs
NADPH tetracyclohexanamine functions as an important cofactor in a variety of metabolic and biosynthetic pathways. NADPH tetracyclohexanamine is an endogenous inhibitor of ferroptosis. NADPH tetracyclohexanamine plays a vital role in the biosynthesis of agents, chiral alcohols, fatty acids and biopolymers, while also being required for lipid biosynthesis, biomass formation, and cell replication ^[3] .

HY-F0003

NADPH tetrasodium salt 10+ Cited Publications		Nucleotide Analogs
NADPH tetrasodium salt functions as an important cofactor in a variety of metabolic and biosynthetic pathways. NADPH tetrasodium salt is an endogenous inhibitor of ferroptosis. NADPH tetrasodium salt plays a vital role in the biosynthesis of agents, chiral alcohols, fatty acids and biopolymers, while also being required for lipid biosynthesis, biomass formation, and cell replication ^[3] .

HY-B0361

Aspartame 1 Publications Verification SC-18862		Sweetening Agents
Aspartame (SC-18862) is a methyl ester of a dipeptide. Aspartame can be used as a synthetic nonnutritive sweetener .

HY-W441007

DSPE-Mal		Phospholipids
DSPE-MAL is a phospholipid compound with a maleimide reactive group. DSPE-MAL contains two saturated fatty acids and can self-assemble in water to form a lipid bilayer. DSPE-MAL can be used to prepare liposomes as nanocarriers for active molecules .

HY-132610A

Givosiran sodium 1 Publications Verification ALN-AS1 sodium		siRNAs siRNA drugs
Givosiran sodium is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran sodium downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran sodium can be used for the research of acute intermittent porphyria .

HY-132610

Givosiran 1 Publications Verification ALN-AS1		siRNAs siRNA drugs
Givosiran (ALN-AS1) is a small interfering RNA that targets hepatic aminolevulinate synthase 1 (ALAS1) messenger RNA. Givosiran downregulates ALAS1 mRNA and prevents accumulation of neurotoxic δ-aminolevulinic acid and porphobilinogen levels. Givosiran can be used for the research of acute intermittent porphyria .

HY-125818B

Cytidine-5'-triphosphate sodium hydrate Cytidine triphosphate sodium hydrate; 5'-CTP sodium hydrate		Nucleotide Analogs Cytidine Nucleotide
Cytidine-5'-triphosphate sodium hydrate (Cytidine triphosphate sodium hydrate; 5'-CTP sodium hydrate) is the sodium hydrate form of Cytidine-5'-triphosphate (HY-125818). Cytidine-5'-triphosphate sodium hydrate is a nucleoside triphosphate, that is invovled in biosynthesis of DNA, RNA and lipid .

HY-Y1310

Sodium alginate		Thickeners Disintegrants Suspending Agents
Sodium alginate is the sodium salt of alginic acid. Sodium alginate can be extracted and purified from brown seaweed Laminaria japonica. Sodium alginate can be used in food additives and pharmaceuticals, adsorb heavy metal ions, and has mucosal-protective and hemostatic effects .

HY-125818

Cytidine-5'-triphosphate 2 Publications Verification Cytidine triphosphate; 5'-CTP		Nucleotide Analogs
Cytidine 5′-triphosphate (Cytidine triphosphate; 5'-CTP) is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii .

HY-125818C

Cytidine-5'-triphosphate disodium hydrate Cytidine triphosphate disodium hydrate; 5'-CTP disodium hydrate		Nucleotide Analogs Cytidine Nucleotide
Cytidine 5′-triphosphate is a nucleoside triphosphate and serves as a building block for nucleotides and nucleic acids, lipid biosynthesis. Cytidine triphosphate synthase can catalyze the formation of cytidine 5′-triphosphate from uridine 5′-triphosphate (UTP). Cytidine 5′-triphosphate is an essential biomolecule in the de novo pyrimidine biosynthetic pathway in T. gondii .

Inquiry Online

Your information is safe with us. * Required Fields.

MCE Japan Authorized Agent ナミキ商事株式会社コスモ・バイオ株式会社重松貿易株式会社
Salutation			Country or Region *
Applicant Name *			Organization Name *
Department *
Email Address *			Product Name *
Cat. No.			Requested quantity *
Phone Number *
Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent:

(R)-3-Hydroxybutanoic acid (sodium)

Inhibitors & Agonists

Fluorescent Dye

Biochemical Assay Reagents

Peptides

NaturalProducts

Isotope-Labeled Compounds

Click Chemistry

Oligonucleotides

Natural
Products