1. Search Result
Search Result
Results for "

(R)-3-Hydroxybutanoic acid (sodium)

" in MedChemExpress (MCE) Product Catalog:

3380

Inhibitors & Agonists

74

Fluorescent Dye

300

Biochemical Assay Reagents

1658

Peptides

521

Natural
Products

45

Isotope-Labeled Compounds

81

Click Chemistry

52

Oligonucleotides

Cat. No. Product Name Target Research Areas Chemical Structure
  • HY-W015851
    (R)-3-Hydroxybutanoic acid sodium
    5 Publications Verification

    (R)-(-)-3-Hydroxybutanoic acid sodium; (R)-3-Hydroxybutyric acid sodium

    Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid sodium
  • HY-W051723
    (R)-3-Hydroxybutanoic acid
    5 Publications Verification

    (R)-(-)-3-Hydroxybutanoic acid; (R)-3-Hydroxybutyric acid

    Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid
  • HY-W015851S2

    (R)-(-)-3-Hydroxybutanoic acid-13C4 sodium; (R)-3-Hydroxybutyric acid-13C4 sodium

    Isotope-Labeled Compounds Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid- 13C4 sodium is a 13C labeled (R)-3-Hydroxybutanoic acid (HY-W051723). (R)-3-Hydroxybutanoic acid is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones .
    (R)-3-Hydroxybutanoic acid-13C4 sodium
  • HY-B0228S10

    (R)-(-)-3-Hydroxybutanoic acid-13C2 sodium; (R)-3-Hydroxybutyric acid-13C2 sodium

    Isotope-Labeled Compounds Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid- 13C2 sodium is the 13C labeled (R)-3-Hydroxybutanoic acid sodium (HY-W015851). (R)-3-Hydroxybutanoic acid sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones [3].
    (R)-3-Hydroxybutanoic acid-13C2 sodium
  • HY-W654002

    Isotope-Labeled Compounds Endogenous Metabolite Others
    (3R)-3-Hydroxybutyric acid-1- 13C is 13C labeled (R)-3-Hydroxybutanoic acid. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones [3].
    (3R)-3-Hydroxybutyric acid-1-13C
  • HY-P0041A

    Vasopressin Receptor Neurological Disease
    F992 TFA is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .
    F992 TFA
  • HY-W015851R

    (R)-(-)-3-Hydroxybutanoic acid sodium (Standard); (R)-3-Hydroxybutyric acid sodium (Standard)

    Reference Standards Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid (sodium) (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid (sodium). This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid ((R)-3-Hydroxybutyric acid) sodium is a metabolite converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid sodium can function as a nutrition source, and as a precursor for vitamins, antibiotics and pheromones[1][2].
    (R)-3-Hydroxybutanoic acid sodium (Standard)
  • HY-W051723R

    (R)-(-)-3-Hydroxybutanoic acid (Standard); (R)-3-Hydroxybutyric acid (Standard)

    Reference Standards Endogenous Metabolite Metabolic Disease
    (R)-3-Hydroxybutanoic acid (Standard) is the analytical standard of (R)-3-Hydroxybutanoic acid. This product is intended for research and analytical applications. (R)-3-Hydroxybutanoic acid is a metabolite, and converted from acetoacetic acid catalyzed by 3-hydroxybutyrate dehydrogenase. (R)-3-Hydroxybutanoic acid has applications as a nutrition source and as a precursor for vitamins, antibiotics and pheromones[1][2].
    (R)-3-Hydroxybutanoic acid (Standard)
  • HY-P0041

    Vasopressin Receptor Neurological Disease
    F992 is an antidiuretic peptide and vasopressin (antidiuretic hormone) analogue .
    F992
  • HY-P10876

    Amyloid-β Neurological Disease
    mcK6A1 is an inhibitor for the aggregation of amyloid-β (), that selectively binds to the 16KLVFFA21 segment of Aβ42, forms an extended β-folded structure, and inhibits the formation of Aβ42 oligomers. mcK6A1 can be used in research of Alzheimer's disease and other amyloid-related diseases .
    mcK6A1
  • HY-P10218A

    MARCKS PKC Inflammation/Immunology Cancer
    MANS peptide TFA is the TFA salt form of MANS peptide (HY-P10218). MANS peptide TFA is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .
    MANS peptide TFA
  • HY-P10218

    MARCKS PKC Inflammation/Immunology Cancer
    MANS peptide is an inhibitor for myristoylated alanine-rich C kinase substrate (MARCKS), which competes with MARCKS in cells for membrane binding, and thus inhibits the stimulation of mucin secretion and tumor metastasis .
    MANS peptide
  • HY-169089A

    Drug Derivative Cancer
    RP-182-PEG3-K(palmitic acid) (Compound 1a) TFA is a fatty acid derivative of the immunomodulatory peptide RP-182. RP-182-PEG3-K(palmitic acid) TFA inhibits CD206 high M2-like macrophage (IC50 of 3.2 μM) and induces phagocytosis. RP-182-PEG3-K(palmitic acid) TFA exhibits antitumor efficacy in mouse B16 melanoma allografts .
    RP-182-PEG3-K(palmitic acid) TFA
  • HY-169089

    Drug Derivative Cancer
    RP-182-PEG3-K palmitic acid (Compound 1a) is a fatty acid derivative of the immunomodulatory peptide RP-182. RP-182-PEG3-K palmitic acid inhibits CD206 high M2-like macrophage (IC50 of 3.2 μM) and induces phagocytosis. RP-182-PEG3-K palmitic acid exhibits antitumor efficacy in mouse B16 melanoma allografts .
    RP-182-PEG3-K(palmitic acid)
  • HY-P2231
    Cotadutide
    1 Publications Verification

    MEDI0382

    GCGR Metabolic Disease
    Cotadutide (MEDI0382) is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC50 values of 6.9 pM and 10.2 pM, respectively. Cotadutide exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide can be used in the research of obesity and type 2 diabetes (T2D) [3].
    Cotadutide
  • HY-P2231A
    Cotadutide acetate
    1 Publications Verification

    MEDI0382 acetate

    GCGR Metabolic Disease
    Cotadutide (MEDI0382) acetate is a potent dual agonist of glucagon-like peptide-1 (GLP-1) and GCGR with EC50 values of 6.9 pM and 10.2 pM, respectively. Cotadutide acetate exhibits ability to facilitate both weight loss and glycaemic control, and alleviate fibrosis. Cotadutide acetate can be used in the research of obesity and type 2 diabetes (T2D) [3].
    Cotadutide acetate
  • HY-P0014A

    GLP Receptor Metabolic Disease
    Liraglutide acetate is the acetate form of Liraglutide (HY-P0014), a glucagon-like peptide-1 (GLP-1) receptor agonist studied in type 2 diabetes .
    Liraglutide acetate
  • HY-P0014
    Liraglutide
    25+ Cited Publications

    GCGR GLP Receptor Metabolic Disease Cancer
    Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus.
    Liraglutide
  • HY-P10869
    dCNP
    1 Publications Verification

    Natriuretic Peptide Receptor (NPR) Inflammation/Immunology Cancer
    dCNP binds to NPR-B/C receptor, activates cGMP signaling pathway, and regulates vascular function. dCNP exhibits anti-hypoxia property through downregulation of hypoxia-related genes expressions like HIF1α and HIF2α. dCNP inhibits the induction of tumor stroma and exhibits anti-fibrosis activity. dCNP upregulates CTLs, NK cells, and conventional type 1 dendritic cells in tumors, and activates immune responses .
    dCNP
  • HY-P0014B
    Liraglutide TFA
    25+ Cited Publications

    GLP Receptor Metabolic Disease
    Liraglutide (TFA) is an agonist of glucagon-like peptide 1 receptor (GLP-1). Liraglutide (TFA) can activate GLP-1, leading to the release of insulin in the presence of increased glucose concentration. Liraglutide (TFA) also reduces glucagon secretion in a glucose-dependent manner. Liraglutide (TFA) can be studied in research on type 2 diabetes .
    Liraglutide TFA
  • HY-P10318

    GLP Receptor Endocrinology
    SHR-2042 is a selective agonist of the GLP-1 receptor.SHR-2042 improves glycemic control by activating the GLP-1 receptor, enhancing insulin secretion and inhibiting glucagon secretion. SHR-2042 combined with sodium N-(8-[2-hydroxybenzoyl] amino) caprylate (SNAC) promotes monomerization through the formation of micelles and improves oral absorption efficiency .
    SHR-2042
  • HY-P10200

    Bacterial Infection
    CP7-FP13-2 is a peptide with antivirulence factor and antibacterial activity. CP7-FP13-2 inhibits the formation of Staphylococcus aureus biofilm and has good antibacterial efficacy in mice .
    CP7-FP13-2
  • HY-P3291
    Dapiglutide
    1 Publications Verification

    ZP7570

    GCGR Metabolic Disease
    Dapiglutide (ZP7570) is a long-acting glucagon-like peptide-1 receptor 1R (GLP-1R)/Glucagon-like peptide-2 receptor (GLP-2R) dual agonist. Dapiglutide alleviates intestinal dysfunction in a mouse short bowel model and has anti-obesity effects [3].
    Dapiglutide
  • HY-P11233

    GLP Receptor Metabolic Disease
    Acmopatide (Compound E-153) is a dual-acting GIP/GLP-1 receptor agonist. Acmopatide is used in anti-diabetic research .
    Acmopatide
  • HY-P5161

    GLP Receptor GCGR Metabolic Disease
    FC382K10W15 is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 can be used in type 2 diabetes research .
    FC382K10W15
  • HY-P5161A

    GLP Receptor GCGR Metabolic Disease
    FC382K10W15 TFA is a glucagon analogue and GLP-1R/GCGR agonist. FC382K10W15 TFA can be used in type 2 diabetes research .
    FC382K10W15 TFA
  • HY-P3462
    Cagrilintide
    3 Publications Verification

    CGRP Receptor Metabolic Disease
    Cagrilintide is an investigational novel long-acting acylated amylin analogue, acts as nonselective amylin receptors (AMYR) and calcitonin G protein-coupled receptor (CTR) agonist. Cagrilintide induces significant weight loss and reduces food intake. Cagrilintide has the potential for the research of obesity [3].
    Cagrilintide
  • HY-P3462A
    Cagrilintide acetate
    3 Publications Verification

    CGRP Receptor Metabolic Disease
    Cagrilintide acetate is a non-selective AMYR/CTR agonist and long-acting acylated amylase analogue. Cagrilintide acetate causes a reduction in food intake and significant weight loss in a dose-dependent manner. Cagrilintide acetate can be used in obesity studies [3].
    Cagrilintide acetate
  • HY-P3143

    PD-1/PD-L1 Cancer
    BMSpep-57 is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC50 of 7.68 nM. BMSpep-57 binds to PD-L1 with Kds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 facilitates T cell function by in creasing IL-2 production in PBMCs .
    BMSpep-57
  • HY-P3143A

    PD-1/PD-L1 Cancer
    BMSpep-57 hydrochloride is a potent and competitive macrocyclic peptide inhibitor of PD-1/PD-L1 interaction with an IC50 of 7.68 nM. BMSpep-57 hydrochloride binds to PD-L1 with Kds of 19 nM and 19.88 nM in MST and SPR assays, respectively. BMSpep-57 hydrochloride facilitates T cell function by in creasing IL-2 production in PBMCs .
    BMSpep-57 hydrochloride
  • HY-P0014AS

    Isotope-Labeled Compounds GLP Receptor Metabolic Disease
    Liraglutide-d8 tetraTFA is deuterium labeled Liraglutide (HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used for the study of type 2 diabetes mellitus .
    Liraglutide-d8 tetraTFA
  • HY-P0014S2

    Isotope-Labeled Compounds Others
    Liraglutide- 13C6, 15N (TFA)is the 13C and 15N labeledLiraglutide(HY-P0014). Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .
    Liraglutide-13C6,15N TFA
  • HY-P0014S1

    Isotope-Labeled Compounds GLP Receptor GCGR Others
    Liraglutide- 13C5, 15N (tetraTFA) is the 13C and 15N labeled Liraglutide (HY-P0014) . Liraglutide is a glucagon-like peptide-1 (GLP-1) receptor agonist used clinically to treat type 2 diabetes mellitus .
    Liraglutide-13C5,15N TFA
  • HY-P10271

    NNC0090-2746; MAR709; RO6811135

    GLP Receptor Metabolic Disease
    RG7697 is a dual agonist for glucagon-like peptide receptor (GLP Receptor) and glucosedependent insulinotropic polypeptide receptor (GIPR), with EC50 of 5 and 3 pM, respectively. RG7697 exhibits antihyperglycemic property .
    RG7697
  • HY-P10341

    GCGR Metabolic Disease
    ZP3022 is a dual agonist of glucagon-like peptide-1 (GLP-1) and gastrin that has the ability to sustainably improve glycemic control. Additionally, ZP3022 can effectively increase β-cell mass, promote β-cell proliferation, and enhance the function of pancreatic islets. ZP3022 can be used in anti-diabetic research .
    ZP3022
  • HY-113560

    Antibiotic Fungal Phospholipase Infection
    Plipastatin B1 is a lipopeptide antibiotic, an inhibitor of phospholipase A2 (PLA2), which has antifungal activity .
    Plipastatin B1
  • HY-P11273

    OK 101

    Biochemical Assay Reagents Inflammation/Immunology
    Urcosimod (OK 101) is an immunomodulator and anti-inflammatory agent .
    Urcosimod
  • HY-W040233B

    (S)-2-Hydroxypropanoic acid (sodium) (purity≥90%)

    Drug Intermediate Others
    Sodium (S)-2-hydroxypropanoate (Sodium L-lactate) (purity≥90%) is a buildiing block which can be used as a precursor for the production of the bioplastic polymer poly-lactic acid .
    L-Lactic acid (sodium) (purity≥90%)
  • HY-P11290

    Melanocortin Receptor Metabolic Disease
    MC4-NN2-0453, a α-MSH analog, is a selective MC4R agonist. MC4-NN2-0453 can be used for obesity research .
    MC4-NN2-0453
  • HY-P1162

    SKF 100273

    Vasopressin Receptor Metabolic Disease
    (d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin (SKF 100273) is a vasopressin V1 receptor selective antagonist .
    (d(CH2)51,Tyr(Me)2,Arg8)-Vasopressin
  • HY-P2595

    Endogenous Metabolite Cardiovascular Disease
    SKF 103784 is an vasopressin antagonist with activity against vasopressin. SKF 103784 inhibits the physiological response caused by antidiuretic and is therefore used to study biological processes related to water and salt balance. SKF 103784 can also be used to explore pathological mechanisms related to cardiovascular diseases and endocrine dysfunction .
    SKF 103784
  • HY-153476

    GCGR Metabolic Disease
    GIP/GLP-1 dual receptor agonist-1 (compound 4) is a GIP/GLP-1 receptor agonist. GIP/GLP-1 dual receptor agonist-1 can be used in the research of metabolic disorders and fatty liver diseases, including nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD) .
    GIP/GLP-1 dual receptor agonist-1
  • HY-153476A

    Insulin Receptor GLP Receptor Metabolic Disease
    GIP/GLP-1 dual receptor agonist-1 (Compound 4) (sodium) is a GIP/GLP-1 receptor agonist. GIP/GLP-1 dual receptor agonist-1 (sodium) can be used in the research of metabolic disorders and fatty liver diseases, including nonalcoholic steatohepatitis (NASH) and nonalcoholic fatty liver disease (NAFLD).
    GIP/GLP-1 dual receptor agonist-1 sodium
  • HY-P4895

    Oxytocin Receptor Neurological Disease
    (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin (OVT) is an oxytocin receptor antagonist. (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin can be used for the research of neurological disease .
    (d(CH2)51,Tyr(Me)2,Orn8)-Oxytocin
  • HY-P10272

    PTG-300

    Ferroportin Others
    Rusfertide is a peptide mimetic of natural hepcidin, which targets and degrades ferroportin, reduces serum iron and transferrin-saturation, and thus regulates the production of red blood cells. Rusfertide ameliorates the polycythemia vera, β-thalassemia and hereditary hemochromatosis .
    Rusfertide
  • HY-132582A

    Tau Protein Cancer
    Tau ASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (Tau ASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ )
    Tau ASO-12 (murine) (sodium)
  • HY-W718145

    Biochemical Assay Reagents Others
    D-Mannose,6-(dihydrogen phosphate) (sodium) is a class of biochemical reagents used in glycobiology research. Glycobiology studies the structure, synthesis, biology, and evolution of sugars. It involves carbohydrate chemistry, enzymology of glycan formation and degradation, protein-glycan recognition, and the role of glycans in biological systems. This field is closely related to basic research, biomedicine, and biotechnology .
    D-Mannose,6-dihydrogen phosphate (sodium)
  • HY-134442

    Biochemical Assay Reagents Others
    L-α-Phosphatidylinositol (liver, bovine) (sodium) is a biochemical reagent.
    L-α-Phosphatidylinositol (liver, bovine) (sodium)
  • HY-A0203A
    Pentosan Polysulfate (Sodium) (W/W 43%)
    1 Publications Verification

    HIV Infection Inflammation/Immunology Cancer
    Pentosan Polysulfate Sodium is an orally bioavailable, semi-synthetic medication with anti-inflammatory and pro-chondrogenic properties. Pentosan Polysulfate Sodium also is a potent and selective anti-HIV agent. Pentosan Polysulfate Sodium is used for the treatment of interstitial cystitis [3].
    Pentosan Polysulfate (Sodium) (W/W 43%)
  • HY-N7755

    Estrogen Receptor/ERR Cancer
    Estradiol 3-(β-D-Glucuronide) sodium is the glucuronic acid derivative of estradiol (HY-B0141). Estradiol 3-(β-D-Glucuronide) sodium is radiolabeled for use in tumor imaging and biodistribution studies .
    Estradiol 3-(β-D-Glucuronide) (sodium)

Inquiry Online

Your information is safe with us. * Required Fields.

Salutation

 

Country or Region *

Applicant Name *

 

Organization Name *

Department *

     

Email Address *

 

Product Name *

Cat. No.

 

Requested quantity *

Phone Number *

     

Remarks

Inquiry Online

Inquiry Information

Product Name:
Cat. No.:
Quantity:
MCE Japan Authorized Agent: